First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Part of the loop of an inverted repeat sequenced only by a primer read from one clone. The sequence has been carefully checked and no evidence of compressions found.
16085
16189
First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Region covered by uni-directional primer reads and poor quality terminators.
26460
26463
First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by a terminator read from one clone. This forms part of one arm of an inverted repeat.
36629
36609
First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by terminator read from a single clone.
67059
67059
First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Sequence from 2 terminator reads and one primer read; no read calls this base clearly.
67879
67881
First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by terminator read from a single clone.
87776
87699
First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by a single clone and short insert reads derived from that clone.
23417
24400
First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - 31 copies of a tandem repeat, each element 33bp long and typical sequence: AACCAATCAGCGATAAGCTACACCCACTTTTGG The size of the assembly has not been verified by restriction digest.
72365
80598
First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Approximately 44 copies of a tandem repeat, each element 185bp long and typical sequence: TTCGGGAATCTTTATACATCCGACAAATTCGAGTATGTTA ATATTCTGAATTGGATTCTTTTTCTCGGACATAACTGGTG TTCTGTATTCACTTATGATACGTTCGGCTGCGTACATTGG CCAAGAGTGTTCTAGTAAGAGAATTTCATTTAGAATATGA ACAATTTGGGTAATTGGAAAGTGTC Some base pair differences have been edited.
82062
86122
First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Approximately 24 copies of a tandem repeat, each element 166 bp and typical sequence: TCGTAATTATTCATAAGTTTGTGTTGTCTCAGAGCCATGT CTGAAAAAACAGATTTTTTTTCGAAAATTTTAAAAAGTTC GTAAAAATTGGATTTTTGACAAATCTATGCTCTCTTTTTT TGTTTGAAATTTAGTTCAGTGACAAACAATTTCAAAAATA TAATGT Some base pair differences have been edited.
86139
87724
First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Approximately 58 copies of a tandem repeat, each element 27bp long and typical sequence: TTTTACTCTCTGTGGCTTCCCACCATA Some base pair differences have been edited.
94754
95003
First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by short insert reads derived from a single pUC clone.