WormBase Tree Display for Sequence: Y54G11A
expand all nodes | collapse all nodes | view schema
Y54G11A | DNA | Y54G11A | 99416 | ||
---|---|---|---|---|---|
SMap | S_child (11) | ||||
Structure | From | Source | CHROMOSOME_II | ||
Overlap_right | R06A4 | 99317 | |||
Overlap_left | Y48B6A | ||||
Clone_left_end | Y54G11 | 1 | |||
R06A4 | 99317 | ||||
Y54G11A | 1 | ||||
Clone_right_end | Y48B6 | 58279 | |||
Y54G11A | 99416 | ||||
DB_info | Database | EMBL | NDB_AC | AL034488 | |
NDB_SV | AL034488.3 | ||||
Secondary_accession | Z98868 | ||||
DB_remark | [020426 dl] The region 46842..61342 was finished with the aid of sequence provided by Joy Liang of the Chalfie Lab | ||||
[121025] Sequence correction: SNP 0 bases @ 10383 | |||||
[121025] Sequence correction: SNP 0 bases @ 25273 | |||||
[121025] Sequence correction: SNP 0 bases @ 60136 | |||||
[121025] Sequence correction WBsf268016 : Insertion G1 bases from @ 16180 | |||||
Keyword | HTG | ||||
EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
Origin | From_author | Wallis JM | |||
From_laboratory | HX | ||||
Date_directory | 020424 | ||||
Species | Caenorhabditis elegans | ||||
Strain | WBStrain00000001 | ||||
Visible | Clone | Y54G11A | |||
Properties (3) | |||||
Map | Sequence-II | Ends | Left | 8177 | |
Right | 8230 | ||||
Interpolated_map_position | II | 22.9016 | |||
Assembly_tags | Finished Left | 1 | 6 | Y54G11A | |
Clone left end | 1 | 6 | Y54G11 | ||
99317 | 99322 | R06A4 | |||
annotation | 9205 | 9189 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Part of the loop of an inverted repeat sequenced only by a primer read from one clone. The sequence has been carefully checked and no evidence of compressions found. | ||
16085 | 16189 | First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Region covered by uni-directional primer reads and poor quality terminators. | |||
26460 | 26463 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by a terminator read from one clone. This forms part of one arm of an inverted repeat. | |||
36629 | 36609 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by terminator read from a single clone. | |||
67059 | 67059 | First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Sequence from 2 terminator reads and one primer read; no read calls this base clearly. | |||
67879 | 67881 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by terminator read from a single clone. | |||
87776 | 87699 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by a single clone and short insert reads derived from that clone. | |||
23417 | 24400 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - 31 copies of a tandem repeat, each element 33bp long and typical sequence: AACCAATCAGCGATAAGCTACACCCACTTTTGG The size of the assembly has not been verified by restriction digest. | |||
72365 | 80598 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Approximately 44 copies of a tandem repeat, each element 185bp long and typical sequence: TTCGGGAATCTTTATACATCCGACAAATTCGAGTATGTTA ATATTCTGAATTGGATTCTTTTTCTCGGACATAACTGGTG TTCTGTATTCACTTATGATACGTTCGGCTGCGTACATTGG CCAAGAGTGTTCTAGTAAGAGAATTTCATTTAGAATATGA ACAATTTGGGTAATTGGAAAGTGTC Some base pair differences have been edited. | |||
82062 | 86122 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Approximately 24 copies of a tandem repeat, each element 166 bp and typical sequence: TCGTAATTATTCATAAGTTTGTGTTGTCTCAGAGCCATGT CTGAAAAAACAGATTTTTTTTCGAAAATTTTAAAAAGTTC GTAAAAATTGGATTTTTGACAAATCTATGCTCTCTTTTTT TGTTTGAAATTTAGTTCAGTGACAAACAATTTCAAAAATA TAATGT Some base pair differences have been edited. | |||
86139 | 87724 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - Approximately 58 copies of a tandem repeat, each element 27bp long and typical sequence: TTTTACTCTCTGTGGCTTCCCACCATA Some base pair differences have been edited. | |||
94754 | 95003 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Region covered only by short insert reads derived from a single pUC clone. | |||
Consensus Sequence | 46843 | 45002 | Consensus Sequence derived from catalase.liang | ||
49743 | 46744 | Consensus Sequence derived from catalase.liang | |||
52643 | 49644 | Consensus Sequence derived from catalase.liang | |||
55543 | 52544 | Consensus Sequence derived from catalase.liang | |||
58443 | 55444 | Consensus Sequence derived from catalase.liang | |||
61343 | 58344 | Consensus Sequence derived from catalase.liang | |||
Clone right end | 58274 | 58279 | Y48B6 | ||
Finished Right | 99416 | 99413 | Y54G11A | ||
Method | Genomic_canonical |