WormBase Tree Display for Variation: WBVar00274962

WBVar00274962 Evidence: Paper_evidence: WBPaper00005044
  Name: Public_name: v33
    HGVSg: CHROMOSOME_II:g.8124162_8125040del
  Sequence_details: SMap: S_parent: Sequence: C41C4
    Flanking_sequences: ccgtatcccttccatttattacgttggctta gtttgatgaaaagaatcgtggaaagacctg
    Mapping_target: C41C4
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033316
    Laboratory: RE
    Status: Live
  Affects: Gene: WBGene00002147
    Transcript: C41C4.4a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-600
        CDS_position: ?-530
        Protein_position: ?-177
        Intron_number: 2-4/11
        Exon_number: 1-5/12
    Interactor (141)
  Isolation: Mutagen: EMS
  Genetics: Interpolated_map_position: II 0.694564
  Description: Phenotype (20)
    Phenotype_not_observed: WBPhenotype:0000062 Paper_evidence: WBPaper00005044
        Curator_confirmed: WBPerson712
        Remark: ire-1(v33) mutants were viable. Paper_evidence: WBPaper00005044
            Curator_confirmed: WBPerson712
      WBPhenotype:0000114 Paper_evidence: WBPaper00036076
          WBPaper00041065
        Curator_confirmed: WBPerson2987
        Remark: "To determine whether the transcription of rnf-121 is regulated by PEK-1 and the UPR pathway in C . elegans , we performed a real-time PCR analysis of the mutant strains pek-1 ( ok275 ) , ire-1 ( v33 ) , and atf-6 ( ok551 ) , as well as of wild-type worms , treated with the UPR inducers DTT , tunicamycin , and thapsigargin . Although the mRNA levels of hsp-4 were induced upon tunicamycin or DTT treatment and in pek-1 ( ok275 ) and atf-6 ( ok551 ) mutant backgrounds , and abolished in ire-1 ( v33 ) as shown previously ( Shen et al. , 2001 ) , the levels of rnf-121 mRNA were largely unaffected ( Figure 3B ) ." Paper_evidence: WBPaper00036076
            Curator_confirmed: WBPerson2987
          The ire-1(v33) mutation did not affect mRNA levels of genes 4R79.2, Y39G10AR.8, rpl-1, ZK1098.4, and cpl-1 (Table 1) Paper_evidence: WBPaper00041065
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000137 Paper_evidence: WBPaper00041065
        Curator_confirmed: WBPerson2987
        Remark: "TM (tunicamycin) induction of F48E8.6 did not require ire-1, atf-6, or pek-1, suggesting that its induction did not require any single UPR pathway or that it uses an unconventional UPR pathway (Fig. 1B)." Paper_evidence: WBPaper00041065
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00004565 Paper_evidence: WBPaper00041065
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000424 Paper_evidence: WBPaper00042060
        Curator_confirmed: WBPerson2987
        Remark: "Mutants of the two major components of the UPR pathway in C. elegans, ire-1 and xbp-1 (49), were fully sensitive to levamisole and had normal levels of L-AChRs at the NMJ based on immunostaining (Fig. S5 A and B)." (Antibody staining of UNC-38 was normal) Paper_evidence: WBPaper00042060
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000845 Paper_evidence: WBPaper00042060
        Curator_confirmed: WBPerson2987
        Remark: "Mutants of the two major components of the UPR pathway in C. elegans, ire-1 and xbp-1 (49), were fully sensitive to levamisole and had normal levels of L-AChRs at the NMJ based on immunostaining (Fig. S5 A and B)." Paper_evidence: WBPaper00042060
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001006 Paper_evidence: WBPaper00033126
        Curator_confirmed: WBPerson2021
        Remark: When the worms were fed with bacteria, the pumping rate in ire-1(v33) animals was only slightly decreased (not statistically significant) compared to WT animals Paper_evidence: WBPaper00033126
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001990 Paper_evidence: WBPaper00037064
        Curator_confirmed: WBPerson2987
      WBPhenotype:0002423 Paper_evidence: WBPaper00049307
        Curator_confirmed: WBPerson2987
        Remark: "Mutation of the ER-UPR genes ire-1 and xbp-1 did not suppress Neuro-Nmnat1(gcIs30[Neuro-m-nonN-Nmnat1]) hypoxic survival." (Figure S3b) Paper_evidence: WBPaper00049307
            Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0001666 PATO:0000460 Paper_evidence: WBPaper00049307
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: gcIs30 [Neuro-m-nonN-Nmnat1] Paper_evidence: WBPaper00049307
              Curator_confirmed: WBPerson2987
  Reference (13)
  Remark: A 878 bp deletion extending from 199 bp upstream of the ATG start codon to bp 679 of ire-1 gene. Paper_evidence: WBPaper00005044
  Method: Deletion_allele