WormBase Tree Display for Variation: WBVar00274962
expand all nodes | collapse all nodes | view schema
| WBVar00274962 | Evidence | Paper_evidence | WBPaper00005044 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | v33 | |||||||
| HGVSg | CHROMOSOME_II:g.8124162_8125040del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C41C4 | |||||
| Flanking_sequences | ccgtatcccttccatttattacgttggctta | gtttgatgaaaagaatcgtggaaagacctg | |||||||
| Mapping_target | C41C4 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00033316 | ||||||||
| Laboratory | RE | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00002147 | |||||||
| Transcript | C41C4.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| cDNA_position | ?-600 | ||||||||
| CDS_position | ?-530 | ||||||||
| Protein_position | ?-177 | ||||||||
| Intron_number | 2-4/11 | ||||||||
| Exon_number | 1-5/12 | ||||||||
| Interactor | WBInteraction000003954 | ||||||||
| WBInteraction000003955 | |||||||||
| WBInteraction000051435 | |||||||||
| WBInteraction000500231 | |||||||||
| WBInteraction000520460 | |||||||||
| WBInteraction000520461 | |||||||||
| WBInteraction000520462 | |||||||||
| WBInteraction000520656 | |||||||||
| WBInteraction000536400 | |||||||||
| WBInteraction000536417 | |||||||||
| WBInteraction000536420 | |||||||||
| WBInteraction000536537 | |||||||||
| WBInteraction000536538 | |||||||||
| WBInteraction000536539 | |||||||||
| WBInteraction000536540 | |||||||||
| WBInteraction000536541 | |||||||||
| WBInteraction000536542 | |||||||||
| WBInteraction000536543 | |||||||||
| WBInteraction000536544 | |||||||||
| WBInteraction000536545 | |||||||||
| WBInteraction000536546 | |||||||||
| WBInteraction000536547 | |||||||||
| WBInteraction000536548 | |||||||||
| WBInteraction000536549 | |||||||||
| WBInteraction000536550 | |||||||||
| WBInteraction000536551 | |||||||||
| WBInteraction000536552 | |||||||||
| WBInteraction000536553 | |||||||||
| WBInteraction000536554 | |||||||||
| WBInteraction000536555 | |||||||||
| WBInteraction000536556 | |||||||||
| WBInteraction000536557 | |||||||||
| WBInteraction000536558 | |||||||||
| WBInteraction000536559 | |||||||||
| WBInteraction000536560 | |||||||||
| WBInteraction000536561 | |||||||||
| WBInteraction000536562 | |||||||||
| WBInteraction000536563 | |||||||||
| WBInteraction000536564 | |||||||||
| WBInteraction000536565 | |||||||||
| WBInteraction000536566 | |||||||||
| WBInteraction000536567 | |||||||||
| WBInteraction000536568 | |||||||||
| WBInteraction000536569 | |||||||||
| WBInteraction000536570 | |||||||||
| WBInteraction000536571 | |||||||||
| WBInteraction000536572 | |||||||||
| WBInteraction000536573 | |||||||||
| WBInteraction000536574 | |||||||||
| WBInteraction000536575 | |||||||||
| WBInteraction000536576 | |||||||||
| WBInteraction000536577 | |||||||||
| WBInteraction000536578 | |||||||||
| WBInteraction000536579 | |||||||||
| WBInteraction000536580 | |||||||||
| WBInteraction000536581 | |||||||||
| WBInteraction000536582 | |||||||||
| WBInteraction000536583 | |||||||||
| WBInteraction000536584 | |||||||||
| WBInteraction000536585 | |||||||||
| WBInteraction000536586 | |||||||||
| WBInteraction000536587 | |||||||||
| WBInteraction000536588 | |||||||||
| WBInteraction000536589 | |||||||||
| WBInteraction000536590 | |||||||||
| WBInteraction000536591 | |||||||||
| WBInteraction000536592 | |||||||||
| WBInteraction000536593 | |||||||||
| WBInteraction000536594 | |||||||||
| WBInteraction000536595 | |||||||||
| WBInteraction000536596 | |||||||||
| WBInteraction000536597 | |||||||||
| WBInteraction000536598 | |||||||||
| WBInteraction000536599 | |||||||||
| WBInteraction000536600 | |||||||||
| WBInteraction000536601 | |||||||||
| WBInteraction000536602 | |||||||||
| WBInteraction000536603 | |||||||||
| WBInteraction000536604 | |||||||||
| WBInteraction000536605 | |||||||||
| WBInteraction000536606 | |||||||||
| WBInteraction000536607 | |||||||||
| WBInteraction000536608 | |||||||||
| WBInteraction000536609 | |||||||||
| WBInteraction000536610 | |||||||||
| WBInteraction000536611 | |||||||||
| WBInteraction000536612 | |||||||||
| WBInteraction000536613 | |||||||||
| WBInteraction000536614 | |||||||||
| WBInteraction000536615 | |||||||||
| WBInteraction000536616 | |||||||||
| WBInteraction000536617 | |||||||||
| WBInteraction000536618 | |||||||||
| WBInteraction000536619 | |||||||||
| WBInteraction000536620 | |||||||||
| WBInteraction000536621 | |||||||||
| WBInteraction000536622 | |||||||||
| WBInteraction000536623 | |||||||||
| WBInteraction000536624 | |||||||||
| WBInteraction000536625 | |||||||||
| WBInteraction000536626 | |||||||||
| WBInteraction000536627 | |||||||||
| WBInteraction000536628 | |||||||||
| WBInteraction000536629 | |||||||||
| WBInteraction000536630 | |||||||||
| WBInteraction000536631 | |||||||||
| WBInteraction000536632 | |||||||||
| WBInteraction000536633 | |||||||||
| WBInteraction000536634 | |||||||||
| WBInteraction000536635 | |||||||||
| WBInteraction000536636 | |||||||||
| WBInteraction000536637 | |||||||||
| WBInteraction000536638 | |||||||||
| WBInteraction000536639 | |||||||||
| WBInteraction000536640 | |||||||||
| WBInteraction000536641 | |||||||||
| WBInteraction000536642 | |||||||||
| WBInteraction000536643 | |||||||||
| WBInteraction000536644 | |||||||||
| WBInteraction000536645 | |||||||||
| WBInteraction000536646 | |||||||||
| WBInteraction000536647 | |||||||||
| WBInteraction000536648 | |||||||||
| WBInteraction000536649 | |||||||||
| WBInteraction000536650 | |||||||||
| WBInteraction000536651 | |||||||||
| WBInteraction000536652 | |||||||||
| WBInteraction000536653 | |||||||||
| WBInteraction000536654 | |||||||||
| WBInteraction000536655 | |||||||||
| WBInteraction000536656 | |||||||||
| WBInteraction000536657 | |||||||||
| WBInteraction000536658 | |||||||||
| WBInteraction000536659 | |||||||||
| WBInteraction000536660 | |||||||||
| WBInteraction000536661 | |||||||||
| WBInteraction000536757 | |||||||||
| WBInteraction000536758 | |||||||||
| WBInteraction000536766 | |||||||||
| WBInteraction000536819 | |||||||||
| WBInteraction000537510 | |||||||||
| Isolation | Mutagen | EMS | |||||||
| Genetics | Interpolated_map_position | II | 0.694564 | ||||||
| Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00005044 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | ire-1(v33) mutant growth was somewhat slower than observed for wild-type animals. | Paper_evidence | WBPaper00005044 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000059 | Paper_evidence | WBPaper00026830 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | ire-1(v33); atf-6(ok551) +/ + pek-1(ok275) heterozygotes died, whereas their parents (which had the same genotype) lived, shows that ire-1 has a maternal effect | Paper_evidence | WBPaper00026830 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00026830 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | ire-1(v33); atf-6(ok551) +/+pek-1(ok275) | Paper_evidence | WBPaper00026830 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000136 | Paper_evidence | WBPaper00041065 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | The ire-1(v33) mutation resulted in increased mRNA levels of genes crt-1, arf-6, F48E8.6, exos-3, and K06A5.8 (Table 1). "Quantitative RT-PCR (qRT-PCR) revealed that the basal expression of 3 of these 10 genes (F48E8.6, exos-3, and K06A5.8) was elevated more than twofold in the ire-1(v33) mutant compared with the wild type, whereas expression of crt-1 was reduced to 44% in the atf-6(tm1153) mutant (Table 1)." | Paper_evidence | WBPaper00041065 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000137 | Paper_evidence | WBPaper00035294 | |||||||
| WBPaper00036076 | |||||||||
| WBPaper00041065 | |||||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "In the control wild-type N2 worms, expression of ubiquilin and erasin transcripts increased after 6 h of tunicamycin treatment (Fig. 8). However, the induction of both genes was almost completely attenuated in ire-1(v33) mutant worms, and partially attenuated in the atf-6(ok551) and pek-1(ok275) mutants (Fig. 8). Together, these results indicate that in C. elegans, both ubiquilin and erasin genes are chiefly regulated by ire-1." | Paper_evidence | WBPaper00035294 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| "To determine whether the transcription of rnf-121 is regulated by PEK-1 and the UPR pathway in C . elegans , we performed a real-time PCR analysis of the mutant strains pek-1 ( ok275 ) , ire-1 ( v33 ) , and atf-6 ( ok551 ) , as well as of wild-type worms , treated with the UPR inducers DTT , tunicamycin , and thapsigargin . Although the mRNA levels of hsp-4 were induced upon tunicamycin or DTT treatment and in pek-1 ( ok275 ) and atf-6 ( ok551 ) mutant backgrounds , and abolished in ire-1 ( v33 ) as shown previously ( Shen et al. , 2001 ) , the levels of rnf-121 mRNA were largely unaffected ( Figure 3B ) ." | Paper_evidence | WBPaper00036076 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| "... the induction of crt-1 required ire-1 but not atf-6, indicating that crt-1 requires atf-6 for constitutive expression during larval development and requires ire-1/xbp-1 for induction upon acute ER stress, consistent with previous findings (34)." | Paper_evidence | WBPaper00041065 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00035294 | |||||
| WBPaper00041065 | |||||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000229 | Paper_evidence | WBPaper00032255 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | v33 is clearly smaller than the other ER stress transducer strains. | Paper_evidence | WBPaper00032255 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000273 | Paper_evidence | WBPaper00033126 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | ire-1 mutant animals had significantly reduced motility in liquid media | Paper_evidence | WBPaper00033126 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000294 | Paper_evidence | WBPaper00033126 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | The intestines of mutants remained "dark" due to the lack of lipid droplet hydrolysis. | Paper_evidence | WBPaper00033126 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000457 | Paper_evidence | WBPaper00033126 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | ire-1 mutant animals had lower survival rates upon prolonged fasting. Mutant animals displayed substantial paralysis phenotypes upon starvation | Paper_evidence | WBPaper00033126 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000848 | Paper_evidence | WBPaper00032255 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | In the absence of Cry5B, nearly all worms developed to the L4 stage or adulthood for all strains with the exception of ire-1(v33). | Paper_evidence | WBPaper00032255 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001013 | Paper_evidence | WBPaper00045520 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "C. elegans strains lacking xbp-1 and ire-1 displayed enhanced susceptibility to pathogen resulting in complete death of the animals at 16 and 20 h, respectively (Fig. 5)." | Paper_evidence | WBPaper00045520 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0042742 | PATO:0000460 | Paper_evidence | WBPaper00045520 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001278 | Paper_evidence | WBPaper00042524 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We tested whether the cell-nonautonomous activation of the hsp-4p promoter observed in the intestine of rab-3p::xbp-1s animals was also dependent upon an intact UPR-ER. We first expressed rab-3p::xbp-1s in hsp-4p::GFP animals that had an ire-1(v33) mutant background, with an 878 bp deletion extending from 199 bp upstream of the ATG start codon to bp 679 of the ire-1 gene. We found that the ire-1(v33) mutation prevented UPR-ER activation in the intestine of rab-3p::xbp-1s animals, whereas neuronal UPR-ER activation was still significantly upregulated, suggesting that endogenous IRE-1 signaling is required for cell-nonautonomous UPR-ER activation in distal cells (Figures 6A, 6B, S6A, and S6C)." | Paper_evidence | WBPaper00042524 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00042524 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | rab-3p::xbp-1s; hsp-4p::GFP | Paper_evidence | WBPaper00042524 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001719 | Paper_evidence | WBPaper00030877 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | The induction of crt-1 was almost abolished in both ire-1(v33) and xbp-1(zc12) mutant worms | Paper_evidence | WBPaper00030877 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00030877 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Analysis of crt-1 expression under TM (30 ug/ml) stress | Paper_evidence | WBPaper00030877 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001724 | Paper_evidence | WBPaper00030877 | |||||||
| WBPaper00005044 | |||||||||
| WBPaper00036076 | |||||||||
| WBPaper00037064 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson712 | |||||||||
| WBPerson2987 | |||||||||
| Remark | v33 mutants are hypersensitive to TM stress | Paper_evidence | WBPaper00030877 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| On plates with 2 ug/ml of tunicamycin, only 9% of ire-1 animals matured to the L4 stage or older, 60% arrested at or prior to the L3 stage, and 31% were dead. Whereas in the absence of tunicamycin mutants matured to the L4 stage or older within 3 days. N2 animals were resistant to this concentration. | Paper_evidence | WBPaper00005044 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| "The ire-1 ( v33 ) and pek-1 ( ok275 ) mutant strains are more sensitive to tunicamycin than the wild-type ( Figure 3A , bars ; Shen et al . , 2001 ) , whereas atf-6 ( ok551 ) worms are less sensitive to tunicamycin ( Shen et al. , 2005 ) , and in our hands are more resistant than the wild type ( Figure 3A , bars ) ." | Paper_evidence | WBPaper00036076 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| "Indeed, in an assay of Tm-induced developmental arrest, both zc14 and tm400 homozygotes and v33 heterozygotes were Tm resistant, whereas v33 homozygotes were Tm hypersensitive, as had been reported previously (Fig. 5C) (48). | Paper_evidence | WBPaper00037064 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00005044 | |||||
| WBPaper00036076 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2987 | |||||||||
| EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00030877 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00005044 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | For the TM sensitivity assay, gravid adult worms of indicated strain were allowed to lay eggs on plates containing various amount of TM (0, 2, 5, or 10 ug/ml) for 4 h, after which the adults were removed from the plates. The developmental stages of the worms were examined after three days | Paper_evidence | WBPaper00030877 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001834 | Paper_evidence | WBPaper00005044 | |||||||
| WBPaper00037064 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPerson2987 | |||||||||
| Remark | Splicing of xbp-1 mRNA to remove 23 bases was induced between 30 min - 1 hr after tunicamycin treatment in wild-type L2 larvae. Significantly, this novel mRNA species was not detected in ire-1(v33) mutants. | Paper_evidence | WBPaper00005044 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| "All three ire-1 alleles failed to produce detectable levels of spliced XBP-1 under normal conditions or after an HP incubation (Fig. 6D and E)." | Paper_evidence | WBPaper00037064 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001835 | Paper_evidence | WBPaper00033126 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | In contrast to wild-type, oxygen consumption rates in ire-1 mutant animals were significantly decreased during fasting | Paper_evidence | WBPaper00033126 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001838 | Paper_evidence | WBPaper00005044 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | In ire-1(v33) mutants, the basal expression of the two hsp genes was similar to that of N2 animals. However, the induction of the hsp-3 gene by DTT or tunicamycin was greatly reduced, and that of hsp-4 was almost abolished. | Paper_evidence | WBPaper00005044 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00005044 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBMol:00004908 | Paper_evidence | WBPaper00005044 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001844 | Paper_evidence | WBPaper00033126 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Unlike WT animals, both the number and size of the fat granules inside the intestine remained virtually unchanged in ire-1 mutants after fasting. ire-1 mutant animals fail to hydrolyze fat granules during starvation | Paper_evidence | WBPaper00033126 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0002059 | Paper_evidence | WBPaper00032255 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | In the presence of low to moderate levels of the pore forming toxin (PFT) Cry5B, wild-type worms are slightly intoxicated compared to those found on control no-toxin plates, as evidenced by their smaller sizes and paler appearances. However, the mutant worms are more severely intoxicated than wild-type worms as they are relatively smaller and considerably paler compared to their corresponding no toxin controls. NOTE: caution is called for in interpreting the ire-1(v33) data since many of these animals also have significant overt defects, e.g., developmental delays which prevents them from being as well synchronized at the start of the assay compared to the other strains. | Paper_evidence | WBPaper00032255 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00005329 | Paper_evidence | WBPaper00032255 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002422 | Paper_evidence | WBPaper00037064 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Indeed, in an assay of Tm-induced developmental arrest, both zc14 and tm400 homozygotes and v33 heterozygotes were Tm resistant, whereas v33 homozygotes were Tm hypersensitive, as had been reported previously (Fig. 5C) (48). | Paper_evidence | WBPaper00037064 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | ire-1(v33)/+ | Paper_evidence | WBPaper00037064 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002423 | Paper_evidence | WBPaper00037064 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Tunicamycin (Tm) preconditioning in wild type worms leads to increased tolerance to hypoxia. "... three loss-of-function mutant alleles of ire-1 (Fig. 3B), two alleles of atf-6 (Fig. 3D), and an allele of xbp-1 (Fig. 3F) all were defective for Tm preconditioning (Fig. 2D)." | Paper_evidence | WBPaper00037064 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| "HP (hypoxic preconditioning) consistently provided protection from subsequent harsh hypoxic exposure for wild-type animals (Fig. 4A and B)... Two ire-1 alleles (v33 and ok799) blocked HP (Fig. 4C);" | Paper_evidence | WBPaper00037064 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00037064 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00005044 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | ire-1(v33) mutants were viable. | Paper_evidence | WBPaper00005044 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000114 | Paper_evidence | WBPaper00036076 | |||||||
| WBPaper00041065 | |||||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "To determine whether the transcription of rnf-121 is regulated by PEK-1 and the UPR pathway in C . elegans , we performed a real-time PCR analysis of the mutant strains pek-1 ( ok275 ) , ire-1 ( v33 ) , and atf-6 ( ok551 ) , as well as of wild-type worms , treated with the UPR inducers DTT , tunicamycin , and thapsigargin . Although the mRNA levels of hsp-4 were induced upon tunicamycin or DTT treatment and in pek-1 ( ok275 ) and atf-6 ( ok551 ) mutant backgrounds , and abolished in ire-1 ( v33 ) as shown previously ( Shen et al. , 2001 ) , the levels of rnf-121 mRNA were largely unaffected ( Figure 3B ) ." | Paper_evidence | WBPaper00036076 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| The ire-1(v33) mutation did not affect mRNA levels of genes 4R79.2, Y39G10AR.8, rpl-1, ZK1098.4, and cpl-1 (Table 1) | Paper_evidence | WBPaper00041065 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000137 | Paper_evidence | WBPaper00041065 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "TM (tunicamycin) induction of F48E8.6 did not require ire-1, atf-6, or pek-1, suggesting that its induction did not require any single UPR pathway or that it uses an unconventional UPR pathway (Fig. 1B)." | Paper_evidence | WBPaper00041065 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00041065 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000424 | Paper_evidence | WBPaper00042060 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Mutants of the two major components of the UPR pathway in C. elegans, ire-1 and xbp-1 (49), were fully sensitive to levamisole and had normal levels of L-AChRs at the NMJ based on immunostaining (Fig. S5 A and B)." (Antibody staining of UNC-38 was normal) | Paper_evidence | WBPaper00042060 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000845 | Paper_evidence | WBPaper00042060 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Mutants of the two major components of the UPR pathway in C. elegans, ire-1 and xbp-1 (49), were fully sensitive to levamisole and had normal levels of L-AChRs at the NMJ based on immunostaining (Fig. S5 A and B)." | Paper_evidence | WBPaper00042060 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001006 | Paper_evidence | WBPaper00033126 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | When the worms were fed with bacteria, the pumping rate in ire-1(v33) animals was only slightly decreased (not statistically significant) compared to WT animals | Paper_evidence | WBPaper00033126 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001990 | Paper_evidence | WBPaper00037064 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0002423 | Paper_evidence | WBPaper00049307 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Mutation of the ER-UPR genes ire-1 and xbp-1 did not suppress Neuro-Nmnat1(gcIs30[Neuro-m-nonN-Nmnat1]) hypoxic survival." (Figure S3b) | Paper_evidence | WBPaper00049307 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0001666 | PATO:0000460 | Paper_evidence | WBPaper00049307 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | gcIs30 [Neuro-m-nonN-Nmnat1] | Paper_evidence | WBPaper00049307 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00041065 | ||||||||
| WBPaper00042060 | |||||||||
| WBPaper00033126 | |||||||||
| WBPaper00030877 | |||||||||
| WBPaper00037064 | |||||||||
| WBPaper00032255 | |||||||||
| WBPaper00036076 | |||||||||
| WBPaper00005044 | |||||||||
| WBPaper00026830 | |||||||||
| WBPaper00035294 | |||||||||
| WBPaper00042524 | |||||||||
| WBPaper00045520 | |||||||||
| WBPaper00049307 | |||||||||
| Remark | A 878 bp deletion extending from 199 bp upstream of the ATG start codon to bp 679 of ire-1 gene. | Paper_evidence | WBPaper00005044 | ||||||
| Method | Deletion_allele |
