WormBase Tree Display for Variation: WBVar00274962
expand all nodes | collapse all nodes | view schema
WBVar00274962 | Evidence | Paper_evidence | WBPaper00005044 | ||
---|---|---|---|---|---|
Name | Public_name | v33 | |||
HGVSg | CHROMOSOME_II:g.8124162_8125040del | ||||
Sequence_details | SMap | S_parent | Sequence | C41C4 | |
Flanking_sequences | ccgtatcccttccatttattacgttggctta | gtttgatgaaaagaatcgtggaaagacctg | |||
Mapping_target | C41C4 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033316 | ||||
Laboratory | RE | ||||
Status | Live | ||||
Affects | Gene | WBGene00002147 | |||
Transcript | C41C4.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-600 | ||||
CDS_position | ?-530 | ||||
Protein_position | ?-177 | ||||
Intron_number | 2-4/11 | ||||
Exon_number | 1-5/12 | ||||
Interactor (141) | |||||
Isolation | Mutagen | EMS | |||
Genetics | Interpolated_map_position | II | 0.694564 | ||
Description | Phenotype (20) | ||||
Phenotype_not_observed (8) | |||||
Reference (13) | |||||
Remark | A 878 bp deletion extending from 199 bp upstream of the ATG start codon to bp 679 of ire-1 gene. | Paper_evidence | WBPaper00005044 | ||
Method | Deletion_allele |