WormBase Tree Display for Variation: WBVar00142941

WBVar00142941 Evidence: Paper_evidence: WBPaper00027361
  Name: Public_name: e61
    Other_name: e61sd
      F27C1.8.1:c.607G>T
      CE09720:p.Gly203Ter
    HGVSg: CHROMOSOME_I:g.5432445C>A
  Sequence_details: SMap: S_parent: Sequence: F27C1
    Flanking_sequences: ccaggacttgctggaccaccaggacgcgat gacttaccggaaagggacaaccaggagtcg
    Mapping_target: F27C1
    Type_of_mutation: Substitution: g t Paper_evidence: WBPaper00027361
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (325)
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00001067
    Transcript: F27C1.8.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F27C1.8.1:c.607G>T
        HGVSp: CE09720:p.Gly203Ter
        cDNA_position: 607
        CDS_position: 607
        Protein_position: 203
        Exon_number: 1/1
        Codon_change: Gga/Tga
        Amino_acid_change: G/*
    Interactor: WBInteraction000052055
      WBInteraction000052058
      WBInteraction000501358
      WBInteraction000501364
      WBInteraction000519055
      WBInteraction000537293
      WBInteraction000537294
  Genetics: Interpolated_map_position: I -0.0011509
    Mapping_data: In_2_point (165)
      In_multi_point (349)
      In_pos_neg_data (72)
  Description: Phenotype (10)
    Phenotype_not_observed: WBPhenotype:0000071 Paper_evidence: WBPaper00005747
        Curator_confirmed: WBPerson2987
        Remark: "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." Paper_evidence: WBPaper00005747
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000505 Paper_evidence: WBPaper00001328
        Curator_confirmed: WBPerson712
        Remark: Males are not Ram. Paper_evidence: WBPaper00001328
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006941 PATO:0000460 Paper_evidence: WBPaper00001328
                Curator_confirmed: WBPerson712
          Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00001328
                Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 20C Paper_evidence: WBPaper00001328
              Curator_confirmed: WBPerson712
          Genotype: him-5(e1490) Paper_evidence: WBPaper00001328
              Curator_confirmed: WBPerson712
      WBPhenotype:0000901 Paper_evidence: WBPaper00040002
        Curator_confirmed: WBPerson712
        Remark: mutation has no effect on gland morphology Paper_evidence: WBPaper00040002
            Curator_confirmed: WBPerson712
      WBPhenotype:0001426 Paper_evidence: WBPaper00004883
        Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: arIs37 Paper_evidence: WBPaper00004883
              Curator_confirmed: WBPerson712
      WBPhenotype:0001732 Paper_evidence: WBPaper00032033
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. Paper_evidence: WBPaper00032033
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. Paper_evidence: WBPaper00032033
              Curator_confirmed: WBPerson712
      WBPhenotype:0002176 Paper_evidence: WBPaper00005747
        Curator_confirmed: WBPerson2987
        Remark: "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." Paper_evidence: WBPaper00005747
            Curator_confirmed: WBPerson2987
  Reference (45)
  Remark: Variation stub/paper connection generated from the May 2021 NN VFP dataset.
    Created by WBPerson51134 from the NN_VFP_triage_pipeline
  Method: Substitution_allele