WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
| WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e61 | |||||||
| Other_name | e61sd | ||||||||
| F27C1.8.1:c.607G>T | |||||||||
| CE09720:p.Gly203Ter | |||||||||
| HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F27C1 | |||||
| Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||||
| Mapping_target | F27C1 | ||||||||
| Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (325) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001067 | |||||||
| Transcript | F27C1.8.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F27C1.8.1:c.607G>T | ||||||||
| HGVSp | CE09720:p.Gly203Ter | ||||||||
| cDNA_position | 607 | ||||||||
| CDS_position | 607 | ||||||||
| Protein_position | 203 | ||||||||
| Exon_number | 1/1 | ||||||||
| Codon_change | Gga/Tga | ||||||||
| Amino_acid_change | G/* | ||||||||
| Interactor | WBInteraction000052055 | ||||||||
| WBInteraction000052058 | |||||||||
| WBInteraction000501358 | |||||||||
| WBInteraction000501364 | |||||||||
| WBInteraction000519055 | |||||||||
| WBInteraction000537293 | |||||||||
| WBInteraction000537294 | |||||||||
| Genetics | Interpolated_map_position | I | -0.0011509 | ||||||
| Mapping_data | In_2_point (165) | ||||||||
| In_multi_point (349) | |||||||||
| In_pos_neg_data (72) | |||||||||
| Description | Phenotype (10) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000071 | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | mutation has no effect on gland morphology | Paper_evidence | WBPaper00040002 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002176 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00016541 | ||||||||
| WBPaper00040002 | |||||||||
| WBPaper00029020 | |||||||||
| WBPaper00022976 | |||||||||
| WBPaper00015468 | |||||||||
| WBPaper00014587 | |||||||||
| WBPaper00001328 | |||||||||
| WBPaper00000031 | |||||||||
| WBPaper00014400 | |||||||||
| WBPaper00004883 | |||||||||
| WBPaper00013926 | |||||||||
| WBPaper00005747 | |||||||||
| WBPaper00014397 | |||||||||
| WBPaper00016102 | |||||||||
| WBPaper00016007 | |||||||||
| WBPaper00013904 | |||||||||
| WBPaper00016554 | |||||||||
| WBPaper00032033 | |||||||||
| WBPaper00016529 | |||||||||
| WBPaper00016593 | |||||||||
| WBPaper00004535 | |||||||||
| WBPaper00012408 | |||||||||
| WBPaper00022939 | |||||||||
| WBPaper00015884 | |||||||||
| WBPaper00013649 | |||||||||
| WBPaper00016074 | |||||||||
| WBPaper00014722 | |||||||||
| WBPaper00014843 | |||||||||
| WBPaper00010006 | |||||||||
| WBPaper00018460 | |||||||||
| WBPaper00016317 | |||||||||
| WBPaper00020852 | |||||||||
| WBPaper00015549 | |||||||||
| WBPaper00013930 | |||||||||
| WBPaper00015145 | |||||||||
| WBPaper00010216 | |||||||||
| WBPaper00026393 | |||||||||
| WBPaper00016515 | |||||||||
| WBPaper00016166 | |||||||||
| WBPaper00061173 | |||||||||
| WBPaper00053771 | |||||||||
| WBPaper00061220 | |||||||||
| WBPaper00065293 | |||||||||
| WBPaper00065755 | |||||||||
| WBPaper00065756 | |||||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
| Method | Substitution_allele |
