WormBase Tree Display for Variation: WBVar00091574
expand all nodes | collapse all nodes | view schema
WBVar00091574 | Name | Public_name | ok275 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F46C3.1.1:c.280-15_1760del | ||||||||
HGVSg | CHROMOSOME_X:g.11412305_11414317del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F46C3 | |||||
Flanking_sequences | gtgaatccttcgagacttgagcgtgaaatc | ATTACTTTCCGTATTGGAATAATTAACTAG | |||||||
Mapping_target | F46C3 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK275_external | ||||||||
OK275_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031350 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003970 | |||||||
Transcript | F46C3.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F46C3.1.1:c.280-15_1760del | ||||||||
cDNA_position | ?-1836 | ||||||||
CDS_position | ?-1760 | ||||||||
Protein_position | ?-587 | ||||||||
Intron_number | 3-8/13 | ||||||||
Exon_number | 4-9/14 | ||||||||
Interactor (38) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4569 | ||||||
Description | Phenotype | WBPhenotype:0000119 | Paper_evidence | WBPaper00036076 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To examine whether RNF-121 protein level is regulated by the PEK-1 pathway , we performed immunoblot analysis of RNF-121 : : GFP worms treated with tunicamycin and DTT . Although the level of RNF-121 increases after ER stress in wild-type background , it is constantly high in pek-1 ( ok275 ) worms ( Figure 3C ) and does not increase after ER stress . It suggests that PEK-1 pathway activates RNF-121 translation or protein stability under ER stress conditions , whereas inactivation of PEK-1 during development in the pek- 1 ( ok275 ) mutant may cause ER stress and up-regulation of RNF-121 by an alternative pathway ." | Paper_evidence | WBPaper00036076 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | RNF-121 : : GFP | Paper_evidence | WBPaper00036076 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00005044 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The basal expression of both hsp-3 and hsp-4 was increased in the pek-1(ok275) mutant. | Paper_evidence | WBPaper00005044 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00036076 | |||||||
WBPaper00041065 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To determine whether the transcription of rnf-121 is regulated by PEK-1 and the UPR pathway in C . elegans , we performed a real-time PCR analysis of the mutant strains pek-1 ( ok275 ) , ire-1 ( v33 ) , and atf-6 ( ok551 ) , as well as of wild-type worms , treated with the UPR inducers DTT , tunicamycin , and thapsigargin . Although the mRNA levels of hsp-4 were induced upon tunicamycin or DTT treatment and in pek-1 ( ok275 ) and atf-6 ( ok551 ) mutant backgrounds , and abolished in ire-1 ( v33 ) as shown previously ( Shen et al. , 2001 ) , the levels of rnf-121 mRNA were largely unaffected ( Figure 3B ) ." | Paper_evidence | WBPaper00036076 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
The pek-1(ok275) mutation resulted in increased mRNA levels of genes F48E8.6 and ZK1098.4 (Table 1) | Paper_evidence | WBPaper00041065 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00035294 | |||||||
WBPaper00041065 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In the control wild-type N2 worms, expression of ubiquilin and erasin transcripts increased after 6 h of tunicamycin treatment (Fig. 8). However, the induction of both genes was almost completely attenuated in ire-1(v33) mutant worms, and partially attenuated in the atf-6(ok551) and pek-1(ok275) mutants (Fig. 8). Together, these results indicate that in C. elegans, both ubiquilin and erasin genes are chiefly regulated by ire-1." | Paper_evidence | WBPaper00035294 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
The pek-1(ok275) mutation resulted in decreased mRNA levels of the gene Y39G10AR.8 (Table 1) | Paper_evidence | WBPaper00041065 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00035294 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000199 | Paper_evidence | WBPaper00031700 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Although less pronounced than gcn-1, loss-of-function mutations in a C. elegans PERK homolog, pek-1 (Shen et_al 2001), also suppressed the ray defect in plx-1/smp-1 smp-2 mutants (Fig 1I; Supplemental Table S2) and reduced P-eIF2α (Fig 2A)" | Paper_evidence | WBPaper00031700 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | plx-1(nc37) | Paper_evidence | WBPaper00031700 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
smp-1(ev715) smp-2(ev709) | Paper_evidence | WBPaper00031700 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
plx-1(ev724) | Paper_evidence | WBPaper00031700 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00058677 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Partial blockage of secondary gene's ability to suppress severe behavioral defects: "pek-1 loss of function partially blocks the ability of neuronal overexpression of xbp-1s in Tau (high)animals to suppress severe behavioral defects observed in a liquid environment" (Figure 4a) | Paper_evidence | WBPaper00058677 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00058677 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00058677 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Genotype | aex-3p::hTau (4R1N); myo-2p::gfp; uthls270 [rab-3p::xbp-1s; myo-2p::tdTomato] | Paper_evidence | WBPaper00058677 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00031700 | |||||||
WBPaper00037064 | |||||||||
WBPaper00040453 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Although less pronounced than gcn-1, loss-of-function mutations in a C. elegans PERK homolog, pek-1 (Shen et_al 2001), also suppressed the ray defect in plx-1/smp-1 smp-2 mutants (Fig 1I; Supplemental Table S2) and reduced P-eIF2α (Fig 2A)" | Paper_evidence | WBPaper00031700 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"On the other hand, the significant hypoxic induction of p-eIF2α was blocked in pek-1(ok275), a mutant with normal HP (Fig. 6C)." | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
pek-1(ok275) suppresses the tunicamycin-induced or xbp-1-mutation-induced phosphorylation of eIF2α (Figure 2A, S1A) | Paper_evidence | WBPaper00040453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001724 | Paper_evidence | WBPaper00005044 | |||||||
WBPaper00032255 | |||||||||
WBPaper00036076 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Only 35% of pek-1(ok275) mutants on plates with 2 ug/ml of tunicamycin matured to the L4 stage or older, 31% arrested at or prior to the L3 stage, and 34% were dead. N2 animals were resistant to this concentration. | Paper_evidence | WBPaper00005044 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Mutant animals are more readily killed by tunicamycin. | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
"The ire-1 ( v33 ) and pek-1 ( ok275 ) mutant strains are more sensitive to tunicamycin than the wild-type ( Figure 3A , bars ; Shen et al . , 2001 ) , whereas atf-6 ( ok551 ) worms are less sensitive to tunicamycin ( Shen et al. , 2005 ) , and in our hands are more resistant than the wild type ( Figure 3A , bars ) ." | Paper_evidence | WBPaper00036076 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00005044 | |||||
WBPaper00032255 | |||||||||
WBPaper00036076 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00005044 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed (17) | |||||||||
Reference (14) | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |