WormBase Tree Display for Variation: WBVar00091574
expand all nodes | collapse all nodes | view schema
WBVar00091574 | Name | Public_name | ok275 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F46C3.1.1:c.280-15_1760del | ||||||||
HGVSg | CHROMOSOME_X:g.11412305_11414317del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F46C3 | |||||
Flanking_sequences | gtgaatccttcgagacttgagcgtgaaatc | ATTACTTTCCGTATTGGAATAATTAACTAG | |||||||
Mapping_target | F46C3 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK275_external | ||||||||
OK275_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031350 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003970 | |||||||
Transcript | F46C3.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F46C3.1.1:c.280-15_1760del | ||||||||
cDNA_position | ?-1836 | ||||||||
CDS_position | ?-1760 | ||||||||
Protein_position | ?-587 | ||||||||
Intron_number | 3-8/13 | ||||||||
Exon_number | 4-9/14 | ||||||||
Interactor (38) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4569 | ||||||
Description | Phenotype | WBPhenotype:0000119 | Paper_evidence | WBPaper00036076 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To examine whether RNF-121 protein level is regulated by the PEK-1 pathway , we performed immunoblot analysis of RNF-121 : : GFP worms treated with tunicamycin and DTT . Although the level of RNF-121 increases after ER stress in wild-type background , it is constantly high in pek-1 ( ok275 ) worms ( Figure 3C ) and does not increase after ER stress . It suggests that PEK-1 pathway activates RNF-121 translation or protein stability under ER stress conditions , whereas inactivation of PEK-1 during development in the pek- 1 ( ok275 ) mutant may cause ER stress and up-regulation of RNF-121 by an alternative pathway ." | Paper_evidence | WBPaper00036076 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | RNF-121 : : GFP | Paper_evidence | WBPaper00036076 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00005044 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The basal expression of both hsp-3 and hsp-4 was increased in the pek-1(ok275) mutant. | Paper_evidence | WBPaper00005044 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00036076 | |||||||
WBPaper00041065 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To determine whether the transcription of rnf-121 is regulated by PEK-1 and the UPR pathway in C . elegans , we performed a real-time PCR analysis of the mutant strains pek-1 ( ok275 ) , ire-1 ( v33 ) , and atf-6 ( ok551 ) , as well as of wild-type worms , treated with the UPR inducers DTT , tunicamycin , and thapsigargin . Although the mRNA levels of hsp-4 were induced upon tunicamycin or DTT treatment and in pek-1 ( ok275 ) and atf-6 ( ok551 ) mutant backgrounds , and abolished in ire-1 ( v33 ) as shown previously ( Shen et al. , 2001 ) , the levels of rnf-121 mRNA were largely unaffected ( Figure 3B ) ." | Paper_evidence | WBPaper00036076 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
The pek-1(ok275) mutation resulted in increased mRNA levels of genes F48E8.6 and ZK1098.4 (Table 1) | Paper_evidence | WBPaper00041065 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00035294 | |||||||
WBPaper00041065 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In the control wild-type N2 worms, expression of ubiquilin and erasin transcripts increased after 6 h of tunicamycin treatment (Fig. 8). However, the induction of both genes was almost completely attenuated in ire-1(v33) mutant worms, and partially attenuated in the atf-6(ok551) and pek-1(ok275) mutants (Fig. 8). Together, these results indicate that in C. elegans, both ubiquilin and erasin genes are chiefly regulated by ire-1." | Paper_evidence | WBPaper00035294 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
The pek-1(ok275) mutation resulted in decreased mRNA levels of the gene Y39G10AR.8 (Table 1) | Paper_evidence | WBPaper00041065 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00035294 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000199 | Paper_evidence | WBPaper00031700 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Although less pronounced than gcn-1, loss-of-function mutations in a C. elegans PERK homolog, pek-1 (Shen et_al 2001), also suppressed the ray defect in plx-1/smp-1 smp-2 mutants (Fig 1I; Supplemental Table S2) and reduced P-eIF2α (Fig 2A)" | Paper_evidence | WBPaper00031700 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | plx-1(nc37) | Paper_evidence | WBPaper00031700 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
smp-1(ev715) smp-2(ev709) | Paper_evidence | WBPaper00031700 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
plx-1(ev724) | Paper_evidence | WBPaper00031700 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00058677 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Partial blockage of secondary gene's ability to suppress severe behavioral defects: "pek-1 loss of function partially blocks the ability of neuronal overexpression of xbp-1s in Tau (high)animals to suppress severe behavioral defects observed in a liquid environment" (Figure 4a) | Paper_evidence | WBPaper00058677 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00058677 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00058677 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Genotype | aex-3p::hTau (4R1N); myo-2p::gfp; uthls270 [rab-3p::xbp-1s; myo-2p::tdTomato] | Paper_evidence | WBPaper00058677 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00031700 | |||||||
WBPaper00037064 | |||||||||
WBPaper00040453 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Although less pronounced than gcn-1, loss-of-function mutations in a C. elegans PERK homolog, pek-1 (Shen et_al 2001), also suppressed the ray defect in plx-1/smp-1 smp-2 mutants (Fig 1I; Supplemental Table S2) and reduced P-eIF2α (Fig 2A)" | Paper_evidence | WBPaper00031700 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"On the other hand, the significant hypoxic induction of p-eIF2α was blocked in pek-1(ok275), a mutant with normal HP (Fig. 6C)." | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
pek-1(ok275) suppresses the tunicamycin-induced or xbp-1-mutation-induced phosphorylation of eIF2α (Figure 2A, S1A) | Paper_evidence | WBPaper00040453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001724 | Paper_evidence | WBPaper00005044 | |||||||
WBPaper00032255 | |||||||||
WBPaper00036076 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Only 35% of pek-1(ok275) mutants on plates with 2 ug/ml of tunicamycin matured to the L4 stage or older, 31% arrested at or prior to the L3 stage, and 34% were dead. N2 animals were resistant to this concentration. | Paper_evidence | WBPaper00005044 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Mutant animals are more readily killed by tunicamycin. | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
"The ire-1 ( v33 ) and pek-1 ( ok275 ) mutant strains are more sensitive to tunicamycin than the wild-type ( Figure 3A , bars ; Shen et al . , 2001 ) , whereas atf-6 ( ok551 ) worms are less sensitive to tunicamycin ( Shen et al. , 2005 ) , and in our hands are more resistant than the wild type ( Figure 3A , bars ) ." | Paper_evidence | WBPaper00036076 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00005044 | |||||
WBPaper00032255 | |||||||||
WBPaper00036076 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00005044 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000030 | Paper_evidence | WBPaper00005044 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pek-1(ok275) mutants were indistinguishable from the wild-type under normal growth conditions. | Paper_evidence | WBPaper00005044 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00036076 | |||||||
WBPaper00040397 | |||||||||
WBPaper00041065 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To determine whether the transcription of rnf-121 is regulated by PEK-1 and the UPR pathway in C . elegans , we performed a real-time PCR analysis of the mutant strains pek-1 ( ok275 ) , ire-1 ( v33 ) , and atf-6 ( ok551 ) , as well as of wild-type worms , treated with the UPR inducers DTT , tunicamycin , and thapsigargin . Although the mRNA levels of hsp-4 were induced upon tunicamycin or DTT treatment and in pek-1 ( ok275 ) and atf-6 ( ok551 ) mutant backgrounds , and abolished in ire-1 ( v33 ) as shown previously ( Shen et al. , 2001 ) , the levels of rnf-121 mRNA were largely unaffected ( Figure 3B ) ." | Paper_evidence | WBPaper00036076 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
pek-1(ok275) did not affect the tunicamycin-induced mRNA expression of uggt-1 and hsp-4 | Paper_evidence | WBPaper00040397 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
The pek-1(ok275) mutation did not affect mRNA levels of genes crt-1, arf-6, 4R79.2, exos-3, rpl-1, cpl-1, or K06A5.8 (Table 1) | Paper_evidence | WBPaper00041065 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00041065 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "TM (tunicamycin) induction of F48E8.6 did not require ire-1, atf-6, or pek-1, suggesting that its induction did not require any single UPR pathway or that it uses an unconventional UPR pathway (Fig. 1B)." | Paper_evidence | WBPaper00041065 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
pek-1(ok275) did not affect the tunicamycin-induced expression of crt-1 mRNA (Figure S2) | Paper_evidence | WBPaper00041065 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00041065 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000298 | Paper_evidence | WBPaper00031700 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S1 | Paper_evidence | WBPaper00031700 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00046107 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | From the text: "Next, we investigated Venus::UNC-6 in pek-1(ok275) and atf-6(ok551) mutants, to examine whether the other two pathway of the UPR is involved in localization of UNC-6. In pek-1(ok275) and atf-6(ok551) mutants, Venus::UNC-6 was observed throughout the cytosol in the UNC-6-expressing cells, as observed in wild-type worms. In the neurons of these mutants, Venus::UNC-6 showed punctate distribution throughout the cell body cytosol and axons (Fig. 1L-O). The distribution of Venus::UNC-6 in these mutants was similar to that seen in wild-type worms. These facts suggest that only the ire-1/xbp-1 pathway of the UPR plays a role in UNC-6 localization in the neurons." | Paper_evidence | WBPaper00046107 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Genotype | ghIs9[unc-6p::Venus::unc-6; str-3p::dsRed2] IV | Paper_evidence | WBPaper00046107 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Wild type and mutant worms are healthy adults with similar appearance. | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00040453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | At 16 degrees Celsius, pek-1(ok275) mutants exhibit a wild type growth rate in the presence of Pseudomonas aeruginosa (Figure 5A) | Paper_evidence | WBPaper00040453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 16 | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | C. elegans lacking the UPR respond normally to attack by the pathogenic bacteria Pseudomonas aeruginosa, which does not make a PFT. | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001273 | Paper_evidence | WBPaper00040453 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Unlike the xbp-1 mutant, the development of the pek-1 mutant at 27C was similar to WT." | Paper_evidence | WBPaper00040453 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 27 | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00041022 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "While several of the tested genes had an effect (results not shown), hsp-3 stood out for its strong effect, essentially totally blocking the induction of pnlp-29::GFP normally observed upon infection in adult worms (Fig. 2A). A similar abrogation of reporter gene expression was seen in an atf-6 mutant, but not in a pek-1 mutant background (Fig. S1)." | Paper_evidence | WBPaper00041022 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00041022 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001349 | Paper_evidence | WBPaper00048983 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To evaluate whether either GCN-2 or PEK-1 kinases are required for H2S-dependent phosphorylation of eIF2α, we introduced gcn-2(ok886) or pek-1(ok275) deletion alleles into sqrd-1(tm3378) mutant animals. When exposed to H2S, we observed robust phosphorylation of eIF2α in both pek-1; sqrd-1 and gcn-2; sqrd-1 double mutant animals (Fig. 3, A and B)." | Paper_evidence | WBPaper00048983 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004296 | Paper_evidence | WBPaper00048983 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00058677 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Quoted from paper: "C. elegans with a pek-1 loss of function mutation [pek-1 (-/-)] had normal locomotion (Supplementary Fig. 1a)." | Paper_evidence | WBPaper00058677 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00058677 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00058677 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0001719 | Paper_evidence | WBPaper00030877 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | crt-1 induction was not affected in atf-6(ok551) and pek-1(ok275) mutants | Paper_evidence | WBPaper00030877 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00030877 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Analysis of crt-1 expression under TM (30 ug/ml) stress | Paper_evidence | WBPaper00030877 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00005044 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pek-1(ok275) mutants were able to activate transcription of both hsp genes to a similar extent as the wild-type. | Paper_evidence | WBPaper00005044 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00005044 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004908 | Paper_evidence | WBPaper00005044 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002058 | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In the presence of low to moderate levels of the pore forming toxin (PFT) Cry5B, wild-type worms are slightly intoxicated compared to those found on control no-toxin plates, as evidenced by their smaller sizes and paler appearances. To the same extent seen with wild-type worms, mutant animals are also slightly intoxicated on low to moderate levels of the PFT Cry5B,indicating lack of this gene does not result in overt hypersensitivity or hyper-resistance to Cry5B. Further, no overt difference was observed in sensitivity to PFT in a quantitative dose-dependent lethality assay. Wild type N2 and pek-1(ok275) were both similarly inhibited in their development by increasing percentages of Cry5B. | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005329 | Paper_evidence | WBPaper00032255 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002423 | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Tunicamycin (Tm) preconditioning in wild type worms leads to increased tolerance to hypoxia. "A large deletion mutation in pek-1 or gcn-2 did not block Tm preconditioning (Fig. 2D and 3C, E)." | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"HP (hypoxic preconditioning) consistently provided protection from subsequent harsh hypoxic exposure for wild-type animals (Fig. 4A and B)... the pek-1 deletion mutation had no effect on HP; pek-1(ok275) animals were strongly protected by HP (Fig. 4B)." | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00037064 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (14) | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |