WormBase Tree Display for Variation: WBVar00091574

WBVar00091574 Name: Public_name: ok275
    Other_name: F46C3.1.1:c.280-15_1760del
    HGVSg: CHROMOSOME_X:g.11412305_11414317del
  Sequence_details: SMap: S_parent: Sequence: F46C3
    Flanking_sequences: gtgaatccttcgagacttgagcgtgaaatc ATTACTTTCCGTATTGGAATAATTAACTAG
    Mapping_target: F46C3
    Type_of_mutation: Deletion
    PCR_product: OK275_external
      OK275_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031350
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00003970
    Transcript: F46C3.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F46C3.1.1:c.280-15_1760del
        cDNA_position: ?-1836
        CDS_position: ?-1760
        Protein_position: ?-587
        Intron_number: 3-8/13
        Exon_number: 4-9/14
    Interactor (38)
  Isolation: Mutagen: UV/TMP
  Genetics: Mapping_data: In_multi_point: 4569
  Description: Phenotype: WBPhenotype:0000119 Paper_evidence: WBPaper00036076
        Curator_confirmed: WBPerson2987
        Remark: "To examine whether RNF-121 protein level is regulated by the PEK-1 pathway , we performed immunoblot analysis of RNF-121 : : GFP worms treated with tunicamycin and DTT . Although the level of RNF-121 increases after ER stress in wild-type background , it is constantly high in pek-1 ( ok275 ) worms ( Figure 3C ) and does not increase after ER stress . It suggests that PEK-1 pathway activates RNF-121 translation or protein stability under ER stress conditions , whereas inactivation of PEK-1 during development in the pek- 1 ( ok275 ) mutant may cause ER stress and up-regulation of RNF-121 by an alternative pathway ." Paper_evidence: WBPaper00036076
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: RNF-121 : : GFP Paper_evidence: WBPaper00036076
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000135 Paper_evidence: WBPaper00005044
        Curator_confirmed: WBPerson712
        Remark: The basal expression of both hsp-3 and hsp-4 was increased in the pek-1(ok275) mutant. Paper_evidence: WBPaper00005044
            Curator_confirmed: WBPerson712
      WBPhenotype:0000136 Paper_evidence: WBPaper00036076
          WBPaper00041065
        Curator_confirmed: WBPerson2987
        Remark (2)
      WBPhenotype:0000137 Paper_evidence: WBPaper00035294
          WBPaper00041065
        Curator_confirmed: WBPerson2987
        Remark (2)
        Affected_by: Molecule: WBMol:00004565 Paper_evidence: WBPaper00035294
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000199 Paper_evidence: WBPaper00031700
        Curator_confirmed: WBPerson2987
        Remark: "Although less pronounced than gcn-1, loss-of-function mutations in a C. elegans PERK homolog, pek-1 (Shen et_al 2001), also suppressed the ray defect in plx-1/smp-1 smp-2 mutants (Fig 1I; Supplemental Table S2) and reduced P-eIF2α (Fig 2A)" Paper_evidence: WBPaper00031700
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: plx-1(nc37) Paper_evidence: WBPaper00031700
              Curator_confirmed: WBPerson2987
            smp-1(ev715) smp-2(ev709) Paper_evidence: WBPaper00031700
              Curator_confirmed: WBPerson2987
            plx-1(ev724) Paper_evidence: WBPaper00031700
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000273 Paper_evidence: WBPaper00058677
        Curator_confirmed: WBPerson10038
        Remark: Partial blockage of secondary gene's ability to suppress severe behavioral defects: "pek-1 loss of function partially blocks the ability of neuronal overexpression of xbp-1s in Tau (high)animals to suppress severe behavioral defects observed in a liquid environment" (Figure 4a) Paper_evidence: WBPaper00058677
            Curator_confirmed: WBPerson10038
        Penetrance: Complete: Paper_evidence: WBPaper00058677
              Curator_confirmed: WBPerson10038
        Variation_effect: Loss_of_function_undetermined_extent: Paper_evidence: WBPaper00058677
            Curator_confirmed: WBPerson10038
        Phenotype_assay: Genotype: aex-3p::hTau (4R1N); myo-2p::gfp; uthls270 [rab-3p::xbp-1s; myo-2p::tdTomato] Paper_evidence: WBPaper00058677
              Curator_confirmed: WBPerson10038
      WBPhenotype:0001351 Paper_evidence: WBPaper00031700
          WBPaper00037064
          WBPaper00040453
        Curator_confirmed: WBPerson2987
        Remark (3)
        Affected_by: Molecule: WBMol:00004565 Paper_evidence: WBPaper00040453
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001724 Paper_evidence: WBPaper00005044
          WBPaper00032255
          WBPaper00036076
        Curator_confirmed: WBPerson712
          WBPerson2987
        Remark (3)
        Affected_by: Molecule: WBMol:00004565 Paper_evidence: WBPaper00005044
                WBPaper00032255
                WBPaper00036076
              Curator_confirmed: WBPerson712
                WBPerson2987
        EQ_annotations: Life_stage: WBls:0000035 PATO:0000460 Paper_evidence: WBPaper00005044
                Curator_confirmed: WBPerson712
    Phenotype_not_observed (17)
  Reference (14)
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele