WormBase Tree Display for Expr_pattern: Expr6013

Expr6013 Expression_of: Gene: WBGene00009575
    Reflects_endogenous_expression_of: WBGene00009575
  Homol: Homol_homol: F40F8:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003681
      WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005772 Partial
        Remark: posterior cells
      WBbt:0006751
  Type: Reporter_gene: [F40F8.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCCTTTCTTGTGCTATGTTTGT] 3' and primer B 5' [ACCACGTTGTGGATGTCGT] 3'.
  Pattern: Adult Expression: intestine - posterior cells; Nervous System; head neurons;
    Larval Expression: pharynx; intestine - posterior cells; Nervous System; head neurons; unidentified cells in head;
  Remark: Also expressed in (comments from author) : some cells in head may be the arcade cells.
    Strain: BC10944
  Reference: WBPaper00006525
  Transgene: WBTransgene00002429