WormBase Tree Display for Expr_pattern: Expr6013
expand all nodes | collapse all nodes | view schema
Expr6013 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | F40F8:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | Partial | ||||
Remark | posterior cells | ||||
WBbt:0006751 | |||||
Type | Reporter_gene | [F40F8.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCCTTTCTTGTGCTATGTTTGT] 3' and primer B 5' [ACCACGTTGTGGATGTCGT] 3'. | |||
Pattern | Adult Expression: intestine - posterior cells; Nervous System; head neurons; | ||||
Larval Expression: pharynx; intestine - posterior cells; Nervous System; head neurons; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : some cells in head may be the arcade cells. | ||||
Strain: BC10944 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002429 |