Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6013

expand all nodes | collapse all nodes | view schema

Name Class

Expr6013Expression_ofGeneWBGene00009575
Reflects_endogenous_expression_ofWBGene00009575
HomolHomol_homolF40F8:Expr
Expression_data (2)
TypeReporter_gene[F40F8.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCCTTTCTTGTGCTATGTTTGT] 3' and primer B 5' [ACCACGTTGTGGATGTCGT] 3'.
PatternAdult Expression: intestine - posterior cells; Nervous System; head neurons;
Larval Expression: pharynx; intestine - posterior cells; Nervous System; head neurons; unidentified cells in head;
RemarkAlso expressed in (comments from author) : some cells in head may be the arcade cells.
Strain: BC10944
ReferenceWBPaper00006525
TransgeneWBTransgene00002429