WormBase Tree Display for Expr_pattern: Expr6013
expand all nodes | collapse all nodes | view schema
Expr6013 | Expression_of | Gene | WBGene00009575 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00009575 | ||
Homol | Homol_homol | F40F8:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [F40F8.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCCTTTCTTGTGCTATGTTTGT] 3' and primer B 5' [ACCACGTTGTGGATGTCGT] 3'. | |
Pattern | Adult Expression: intestine - posterior cells; Nervous System; head neurons; | ||
Larval Expression: pharynx; intestine - posterior cells; Nervous System; head neurons; unidentified cells in head; | |||
Remark | Also expressed in (comments from author) : some cells in head may be the arcade cells. | ||
Strain: BC10944 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002429 |