WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e61 | ||||||
Other_name | e61sd | |||||||
F27C1.8.1:c.607G>T | ||||||||
CE09720:p.Gly203Ter | ||||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | ||||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | ||||||
Mapping_target | F27C1 | |||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000065 | |||||||
WBStrain00000418 | ||||||||
WBStrain00000471 | ||||||||
WBStrain00000478 | ||||||||
WBStrain00003970 | ||||||||
WBStrain00003975 | ||||||||
WBStrain00004089 | ||||||||
WBStrain00004368 | ||||||||
WBStrain00004373 | ||||||||
WBStrain00004383 | ||||||||
WBStrain00004390 | ||||||||
WBStrain00004485 | ||||||||
WBStrain00004633 | ||||||||
WBStrain00004957 | ||||||||
WBStrain00004983 | ||||||||
WBStrain00005015 | ||||||||
WBStrain00005021 | ||||||||
WBStrain00005501 | ||||||||
WBStrain00005538 | ||||||||
WBStrain00005542 | ||||||||
WBStrain00005543 | ||||||||
WBStrain00006182 | ||||||||
WBStrain00006183 | ||||||||
WBStrain00006203 | ||||||||
WBStrain00006216 | ||||||||
WBStrain00006219 | ||||||||
WBStrain00006226 | ||||||||
WBStrain00006233 | ||||||||
WBStrain00006247 | ||||||||
WBStrain00006258 | ||||||||
WBStrain00006261 | ||||||||
WBStrain00006262 | ||||||||
WBStrain00006263 | ||||||||
WBStrain00006264 | ||||||||
WBStrain00006413 | ||||||||
WBStrain00006665 | ||||||||
WBStrain00007169 | ||||||||
WBStrain00007264 | ||||||||
WBStrain00007277 | ||||||||
WBStrain00007331 | ||||||||
WBStrain00007580 | ||||||||
WBStrain00007734 | ||||||||
WBStrain00007737 | ||||||||
WBStrain00007738 | ||||||||
WBStrain00007985 | ||||||||
WBStrain00007986 | ||||||||
WBStrain00007987 | ||||||||
WBStrain00008014 | ||||||||
WBStrain00008021 | ||||||||
WBStrain00008442 | ||||||||
WBStrain00008460 | ||||||||
WBStrain00022478 | ||||||||
WBStrain00022479 | ||||||||
WBStrain00022499 | ||||||||
WBStrain00022537 | ||||||||
WBStrain00022541 | ||||||||
WBStrain00022553 | ||||||||
WBStrain00022558 | ||||||||
WBStrain00022568 | ||||||||
WBStrain00022569 | ||||||||
WBStrain00022576 | ||||||||
WBStrain00022582 | ||||||||
WBStrain00022586 | ||||||||
WBStrain00022592 | ||||||||
WBStrain00022676 | ||||||||
WBStrain00023657 | ||||||||
WBStrain00023658 | ||||||||
WBStrain00023659 | ||||||||
WBStrain00023660 | ||||||||
WBStrain00023661 | ||||||||
WBStrain00023662 | ||||||||
WBStrain00023663 | ||||||||
WBStrain00023664 | ||||||||
WBStrain00023666 | ||||||||
WBStrain00023667 | ||||||||
WBStrain00023668 | ||||||||
WBStrain00023669 | ||||||||
WBStrain00023670 | ||||||||
WBStrain00023671 | ||||||||
WBStrain00023672 | ||||||||
WBStrain00023673 | ||||||||
WBStrain00023674 | ||||||||
WBStrain00023675 | ||||||||
WBStrain00023676 | ||||||||
WBStrain00023677 | ||||||||
WBStrain00023678 | ||||||||
WBStrain00023679 | ||||||||
WBStrain00023680 | ||||||||
WBStrain00023682 | ||||||||
WBStrain00023683 | ||||||||
WBStrain00023685 | ||||||||
WBStrain00023686 | ||||||||
WBStrain00023687 | ||||||||
WBStrain00023688 | ||||||||
WBStrain00023689 | ||||||||
WBStrain00023690 | ||||||||
WBStrain00023691 | ||||||||
WBStrain00023692 | ||||||||
WBStrain00023693 | ||||||||
WBStrain00023694 | ||||||||
WBStrain00023695 | ||||||||
WBStrain00023696 | ||||||||
WBStrain00023697 | ||||||||
WBStrain00023698 | ||||||||
WBStrain00023699 | ||||||||
WBStrain00023700 | ||||||||
WBStrain00023702 | ||||||||
WBStrain00023703 | ||||||||
WBStrain00023705 | ||||||||
WBStrain00023706 | ||||||||
WBStrain00023707 | ||||||||
WBStrain00023708 | ||||||||
WBStrain00023711 | ||||||||
WBStrain00023712 | ||||||||
WBStrain00023713 | ||||||||
WBStrain00023714 | ||||||||
WBStrain00023715 | ||||||||
WBStrain00023717 | ||||||||
WBStrain00023718 | ||||||||
WBStrain00023720 | ||||||||
WBStrain00023722 | ||||||||
WBStrain00023723 | ||||||||
WBStrain00023724 | ||||||||
WBStrain00023725 | ||||||||
WBStrain00023726 | ||||||||
WBStrain00023727 | ||||||||
WBStrain00023728 | ||||||||
WBStrain00023729 | ||||||||
WBStrain00023730 | ||||||||
WBStrain00023732 | ||||||||
WBStrain00023734 | ||||||||
WBStrain00023736 | ||||||||
WBStrain00023737 | ||||||||
WBStrain00023739 | ||||||||
WBStrain00023740 | ||||||||
WBStrain00023741 | ||||||||
WBStrain00023742 | ||||||||
WBStrain00023743 | ||||||||
WBStrain00023744 | ||||||||
WBStrain00023745 | ||||||||
WBStrain00023746 | ||||||||
WBStrain00023747 | ||||||||
WBStrain00023748 | ||||||||
WBStrain00023749 | ||||||||
WBStrain00023750 | ||||||||
WBStrain00023751 | ||||||||
WBStrain00023752 | ||||||||
WBStrain00023753 | ||||||||
WBStrain00023754 | ||||||||
WBStrain00023755 | ||||||||
WBStrain00023756 | ||||||||
WBStrain00023757 | ||||||||
WBStrain00023758 | ||||||||
WBStrain00023759 | ||||||||
WBStrain00023760 | ||||||||
WBStrain00023761 | ||||||||
WBStrain00023762 | ||||||||
WBStrain00023763 | ||||||||
WBStrain00023764 | ||||||||
WBStrain00023765 | ||||||||
WBStrain00023766 | ||||||||
WBStrain00023767 | ||||||||
WBStrain00023768 | ||||||||
WBStrain00023769 | ||||||||
WBStrain00023770 | ||||||||
WBStrain00023774 | ||||||||
WBStrain00023777 | ||||||||
WBStrain00023779 | ||||||||
WBStrain00023780 | ||||||||
WBStrain00023784 | ||||||||
WBStrain00023787 | ||||||||
WBStrain00023788 | ||||||||
WBStrain00023789 | ||||||||
WBStrain00023790 | ||||||||
WBStrain00023791 | ||||||||
WBStrain00023792 | ||||||||
WBStrain00023794 | ||||||||
WBStrain00023798 | ||||||||
WBStrain00023799 | ||||||||
WBStrain00023800 | ||||||||
WBStrain00023801 | ||||||||
WBStrain00023802 | ||||||||
WBStrain00023803 | ||||||||
WBStrain00023805 | ||||||||
WBStrain00023807 | ||||||||
WBStrain00023808 | ||||||||
WBStrain00023809 | ||||||||
WBStrain00023810 | ||||||||
WBStrain00023811 | ||||||||
WBStrain00023812 | ||||||||
WBStrain00023814 | ||||||||
WBStrain00023815 | ||||||||
WBStrain00023816 | ||||||||
WBStrain00023817 | ||||||||
WBStrain00023818 | ||||||||
WBStrain00023819 | ||||||||
WBStrain00023821 | ||||||||
WBStrain00023824 | ||||||||
WBStrain00023825 | ||||||||
WBStrain00023826 | ||||||||
WBStrain00023827 | ||||||||
WBStrain00023828 | ||||||||
WBStrain00023829 | ||||||||
WBStrain00023830 | ||||||||
WBStrain00023831 | ||||||||
WBStrain00023832 | ||||||||
WBStrain00023833 | ||||||||
WBStrain00023834 | ||||||||
WBStrain00023835 | ||||||||
WBStrain00023836 | ||||||||
WBStrain00023839 | ||||||||
WBStrain00023840 | ||||||||
WBStrain00023841 | ||||||||
WBStrain00023842 | ||||||||
WBStrain00023843 | ||||||||
WBStrain00023844 | ||||||||
WBStrain00023845 | ||||||||
WBStrain00023846 | ||||||||
WBStrain00023847 | ||||||||
WBStrain00023849 | ||||||||
WBStrain00023850 | ||||||||
WBStrain00023851 | ||||||||
WBStrain00023852 | ||||||||
WBStrain00023853 | ||||||||
WBStrain00023854 | ||||||||
WBStrain00023855 | ||||||||
WBStrain00023856 | ||||||||
WBStrain00023857 | ||||||||
WBStrain00023858 | ||||||||
WBStrain00023859 | ||||||||
WBStrain00023860 | ||||||||
WBStrain00023861 | ||||||||
WBStrain00023862 | ||||||||
WBStrain00023863 | ||||||||
WBStrain00023864 | ||||||||
WBStrain00023865 | ||||||||
WBStrain00023869 | ||||||||
WBStrain00023870 | ||||||||
WBStrain00023871 | ||||||||
WBStrain00023872 | ||||||||
WBStrain00023873 | ||||||||
WBStrain00023874 | ||||||||
WBStrain00023876 | ||||||||
WBStrain00023878 | ||||||||
WBStrain00023879 | ||||||||
WBStrain00023880 | ||||||||
WBStrain00023881 | ||||||||
WBStrain00023884 | ||||||||
WBStrain00023885 | ||||||||
WBStrain00023886 | ||||||||
WBStrain00023887 | ||||||||
WBStrain00023891 | ||||||||
WBStrain00023892 | ||||||||
WBStrain00023893 | ||||||||
WBStrain00023894 | ||||||||
WBStrain00023895 | ||||||||
WBStrain00023897 | ||||||||
WBStrain00023899 | ||||||||
WBStrain00023900 | ||||||||
WBStrain00023901 | ||||||||
WBStrain00023903 | ||||||||
WBStrain00023904 | ||||||||
WBStrain00023905 | ||||||||
WBStrain00023906 | ||||||||
WBStrain00023907 | ||||||||
WBStrain00023908 | ||||||||
WBStrain00023909 | ||||||||
WBStrain00023910 | ||||||||
WBStrain00023911 | ||||||||
WBStrain00023912 | ||||||||
WBStrain00023913 | ||||||||
WBStrain00023914 | ||||||||
WBStrain00023915 | ||||||||
WBStrain00023916 | ||||||||
WBStrain00023917 | ||||||||
WBStrain00023918 | ||||||||
WBStrain00023919 | ||||||||
WBStrain00023920 | ||||||||
WBStrain00023921 | ||||||||
WBStrain00023922 | ||||||||
WBStrain00023923 | ||||||||
WBStrain00023933 | ||||||||
WBStrain00023934 | ||||||||
WBStrain00023935 | ||||||||
WBStrain00023937 | ||||||||
WBStrain00023938 | ||||||||
WBStrain00023939 | ||||||||
WBStrain00023940 | ||||||||
WBStrain00023943 | ||||||||
WBStrain00023944 | ||||||||
WBStrain00023945 | ||||||||
WBStrain00023946 | ||||||||
WBStrain00023947 | ||||||||
WBStrain00023949 | ||||||||
WBStrain00023965 | ||||||||
WBStrain00023977 | ||||||||
WBStrain00026620 | ||||||||
WBStrain00026735 | ||||||||
WBStrain00026847 | ||||||||
WBStrain00026920 | ||||||||
WBStrain00027045 | ||||||||
WBStrain00027088 | ||||||||
WBStrain00027263 | ||||||||
WBStrain00027269 | ||||||||
WBStrain00027279 | ||||||||
WBStrain00027334 | ||||||||
WBStrain00027345 | ||||||||
WBStrain00027389 | ||||||||
WBStrain00028755 | ||||||||
WBStrain00030675 | ||||||||
WBStrain00033500 | ||||||||
WBStrain00033517 | ||||||||
WBStrain00033905 | ||||||||
WBStrain00034126 | ||||||||
WBStrain00034439 | ||||||||
WBStrain00034653 | ||||||||
WBStrain00040032 | ||||||||
WBStrain00040214 | ||||||||
WBStrain00040443 | ||||||||
WBStrain00040929 | ||||||||
WBStrain00040930 | ||||||||
WBStrain00040931 | ||||||||
WBStrain00049794 | ||||||||
WBStrain00054788 | ||||||||
WBStrain00055739 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001067 | ||||||
Transcript | F27C1.8.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F27C1.8.1:c.607G>T | |||||||
HGVSp | CE09720:p.Gly203Ter | |||||||
cDNA_position | 607 | |||||||
CDS_position | 607 | |||||||
Protein_position | 203 | |||||||
Exon_number | 1/1 | |||||||
Codon_change | Gga/Tga | |||||||
Amino_acid_change | G/* | |||||||
Interactor | WBInteraction000052055 | |||||||
WBInteraction000052058 | ||||||||
WBInteraction000501358 | ||||||||
WBInteraction000501364 | ||||||||
WBInteraction000519055 | ||||||||
WBInteraction000537293 | ||||||||
WBInteraction000537294 | ||||||||
Genetics | Interpolated_map_position | I | -0.0011509 | |||||
Mapping_data | In_2_point (165) | |||||||
In_multi_point (349) | ||||||||
In_pos_neg_data (72) | ||||||||
Description | Phenotype | WBPhenotype:0000072 | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | |||||||
Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | ||||
Curator_confirmed | WBPerson3900 | |||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "This ability of a mutation in one collagen to affect others was further confirmed for the non-stage-specific collagen DPY-7, after costaining of the TP14:dpy-5(e61)I;kaIs12(col-19::gfp) strain with the DPY-7 monoclonal antibodies (Fig. 3C, red). In the dorsal/ventral hypodermal cells, DPY-7 localized in a regular but constricted pattern that corresponded to the annular furrows (Fig. 3C, denoted an) and was similar to the COL-19::GFP patterns observed in wild-type and in dpy-5 mutants. Conversely, in the matrix overlying the lateral seam cell cords, DPY-7 expression was abnormal: the DPY-7 staining pattern appeared broken (Fig. 3C, denoted by double-headed arrow) and generally deviated from the wildtype staining pattern in which both annuli (COL-19) and annular furrows (DPY-7) normally extend to appose the lateral ala (Fig. 1C)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | ||||||
WBPaper00005747 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
WBPerson2987 | ||||||||
Remark | strong dumpy; early larvae non-dumpy; e61/+ is very slightly dumpy | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Authors report "strong dpy" (Table 1); "It is interesting to note that the annuli overlying the ventral and dorsal hypodermis are present but differ markedly from wild-type nematodes (Fig. 1E, double-headed arrows) in that they do not oppose the lateral alae (Fig. 3A,E, double-headed arrows). As a result, the cuticle above the lateral hypodermal seam cell cords, having failed to contract normally, is extended, and this results in the characteristic Dpy phenotype." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Semi_dominant | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "In some areas corresponding to the seam cell cords, large vesicles are evident and the tagged protein is found concentrated at the periphery of these structures (Fig. 3D), perhaps indicating a failure in the complete secretion of COL-19::GFP." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000948 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "When the strain TP14:dpy-5(e61) I;kaIs12(col-19::gfp), resulting from crossing TP12:kaIs(col-19::gfp) with the dpy-5(e61) mutant, was examined under epifluorescence, the ala, apparent by means of Nomarski imaging (Fig. 3E), were shown to express COL-19::GFP in a variable manner (Fig. 3B, arrowed). In addition, two distinct regions became apparent: a region overlying the dorsal/ventral hypodermal cells, which showed annuli fluorescing as distinct bands as observed in wildtype TP12:kaIs(col-19::gfp) worms (Fig. 3B-D, denoted an), and a second, extended region of disruption overlying the seam cell cords (Fig. 3B-D, double-headed arrows)... The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)... These data show that mutation of the DPY-5 collagen in these nematodes is sufficient to alter the expression patterns of the COL-19::GFP collagen." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1); "The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1); "The disrupted region did not have the characteristic annuli and instead appeared featureless when viewed by Nomarski microscopy (Fig. 3E, double-headed arrow). The regular annular fluorescence did appear more closely packed than in wildtype nematodes (Fig. 3B-D, denoted an), having a periodicity of approximately 0.75 μm compared with 1.2 μm, respectively, an observation consistent with the shorter length of these adult nematodes." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00053771 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Hypersensitive to the reactive small molecule and prooxidant juglone. | Paper_evidence | WBPaper00053771 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000071 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | mutation has no effect on gland morphology | Paper_evidence | WBPaper00040002 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002176 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00016541 | |||||||
WBPaper00040002 | ||||||||
WBPaper00029020 | ||||||||
WBPaper00022976 | ||||||||
WBPaper00015468 | ||||||||
WBPaper00014587 | ||||||||
WBPaper00001328 | ||||||||
WBPaper00000031 | ||||||||
WBPaper00014400 | ||||||||
WBPaper00004883 | ||||||||
WBPaper00013926 | ||||||||
WBPaper00005747 | ||||||||
WBPaper00014397 | ||||||||
WBPaper00016102 | ||||||||
WBPaper00016007 | ||||||||
WBPaper00013904 | ||||||||
WBPaper00016554 | ||||||||
WBPaper00032033 | ||||||||
WBPaper00016529 | ||||||||
WBPaper00016593 | ||||||||
WBPaper00004535 | ||||||||
WBPaper00012408 | ||||||||
WBPaper00022939 | ||||||||
WBPaper00015884 | ||||||||
WBPaper00013649 | ||||||||
WBPaper00016074 | ||||||||
WBPaper00014722 | ||||||||
WBPaper00014843 | ||||||||
WBPaper00010006 | ||||||||
WBPaper00018460 | ||||||||
WBPaper00016317 | ||||||||
WBPaper00020852 | ||||||||
WBPaper00015549 | ||||||||
WBPaper00013930 | ||||||||
WBPaper00015145 | ||||||||
WBPaper00010216 | ||||||||
WBPaper00026393 | ||||||||
WBPaper00016515 | ||||||||
WBPaper00016166 | ||||||||
WBPaper00061173 | ||||||||
WBPaper00053771 | ||||||||
WBPaper00061220 | ||||||||
WBPaper00065293 | ||||||||
WBPaper00065755 | ||||||||
WBPaper00065756 | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |