WormBase Tree Display for Strain: WBStrain00055739
expand all nodes | collapse all nodes | view schema
| WBStrain00055739 | Genotype | dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X. | ||
|---|---|---|---|---|
| Public_name | ZT72 | |||
| Contains | Gene | WBGene00001067 | ||
| Variation | WBVar00142941 | |||
| Rearrangement | fjDf1 | |||
| fjDf2 | ||||
| fjDf3 | ||||
| fjDf4 | ||||
| Properties | Outcrossed | x1 | ||
| CGC_received | 02 Jun 2023 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson1503 | |||
| Remark | This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
