WormBase Tree Display for Variation: WBVar01429591
expand all nodes | collapse all nodes | view schema
WBVar01429591 | Name | Public_name | tm5917 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C41C4.5c.1:c.208-2_611del | |||||||
C41C4.5c.2:c.208-2_611del | ||||||||
C41C4.5h.1:c.526-2_929del | ||||||||
C41C4.5d.1:c.526-2_929del | ||||||||
C41C4.5a.1:c.268-2_671del | ||||||||
C41C4.5e.1:c.526-2_929del | ||||||||
C41C4.4a.1:c.801+2946_801+3584del | ||||||||
C41C4.5b.1:c.382-2_785del | ||||||||
HGVSg | CHROMOSOME_II:g.8119327_8119965del | |||||||
Sequence_details | SMap | S_parent | Sequence | C41C4 | ||||
Flanking_sequences | cacctcaataataacttttaaaaaaatttt | tacggtttctaaagcactttggccatgttt | ||||||
Mapping_target | C41C4 | |||||||
Source_location | 7 | CHROMOSOME_II | 8119326 | 8119966 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm5917_external | |||||||
tm5917_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5917 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002147 | ||||||
WBGene00006832 | ||||||||
Transcript | C41C4.5e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C41C4.5e.1:c.526-2_929del | |||||||
cDNA_position | ?-956 | |||||||
CDS_position | ?-929 | |||||||
Protein_position | ?-310 | |||||||
Intron_number | 5-6/15 | |||||||
Exon_number | 6-7/16 | |||||||
C41C4.4a.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | C41C4.4a.1:c.801+2946_801+3584del | |||||||
Intron_number | 6/11 | |||||||
C41C4.5c.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C41C4.5c.2:c.208-2_611del | |||||||
cDNA_position | ?-885 | |||||||
CDS_position | ?-611 | |||||||
Protein_position | ?-204 | |||||||
Intron_number | 6-7/14 | |||||||
Exon_number | 7-8/15 | |||||||
C41C4.5c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C41C4.5c.1:c.208-2_611del | |||||||
cDNA_position | ?-950 | |||||||
CDS_position | ?-611 | |||||||
Protein_position | ?-204 | |||||||
Intron_number | 5-6/15 | |||||||
Exon_number | 6-7/16 | |||||||
C41C4.5d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C41C4.5d.1:c.526-2_929del | |||||||
cDNA_position | ?-950 | |||||||
CDS_position | ?-929 | |||||||
Protein_position | ?-310 | |||||||
Intron_number | 5-6/13 | |||||||
Exon_number | 6-7/14 | |||||||
C41C4.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C41C4.5a.1:c.268-2_671del | |||||||
cDNA_position | ?-768 | |||||||
CDS_position | ?-671 | |||||||
Protein_position | ?-224 | |||||||
Intron_number | 4-5/14 | |||||||
Exon_number | 5-6/15 | |||||||
C41C4.5h.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C41C4.5h.1:c.526-2_929del | |||||||
cDNA_position | ?-929 | |||||||
CDS_position | ?-929 | |||||||
Protein_position | ?-310 | |||||||
Intron_number | 4-5/14 | |||||||
Exon_number | 5-6/15 | |||||||
C41C4.5b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C41C4.5b.1:c.382-2_785del | |||||||
cDNA_position | ?-968 | |||||||
CDS_position | ?-785 | |||||||
Protein_position | ?-262 | |||||||
Intron_number | 4-5/14 | |||||||
Exon_number | 5-6/15 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 19854/19855-20493/20494 (639 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |