WormBase Tree Display for Variation: WBVar00251300

WBVar00251300 Name: Public_name: tm2412
    Other_name: H04M03.4.1:c.748-30_910-48del
    HGVSg: CHROMOSOME_IV:g.5887932_5888301del
  Sequence_details: SMap: S_parent: Sequence: H04M03
    Flanking_sequences: ctttgagttttagtttatttgctggaccgt caacatgttatttattagttcgatgaaaca
    Mapping_target: H04M03
    Source_location: 7 CHROMOSOME_IV 5887931 5888302 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2412_external
      tm2412_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004715
      WBStrain00004716
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2412
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019154
      WBGene00173249
      WBGene00167341
    Transcript: H04M03.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: H04M03.4.1:c.748-30_910-48del
        Intron_number: 4-5/8
        Exon_number: 5/9
      H04M03.70
      H04M03.38
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype (19)
    Phenotype_not_observed: WBPhenotype:0000103 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. G. Hermann to the National Bioresource Project of Japan: wild-type gut granules. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: GH
  Reference: WBPaper00035194
  Remark: 17190/17191-17560/17561 (370 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele