WormBase Tree Display for Variation: WBVar00251300
expand all nodes | collapse all nodes | view schema
WBVar00251300 | Name | Public_name | tm2412 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | H04M03.4.1:c.748-30_910-48del | |||||||
HGVSg | CHROMOSOME_IV:g.5887932_5888301del | |||||||
Sequence_details | SMap | S_parent | Sequence | H04M03 | ||||
Flanking_sequences | ctttgagttttagtttatttgctggaccgt | caacatgttatttattagttcgatgaaaca | ||||||
Mapping_target | H04M03 | |||||||
Source_location | 7 | CHROMOSOME_IV | 5887931 | 5888302 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004715 | |||||||
WBStrain00004716 | ||||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2412 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00019154 | ||||||
WBGene00173249 | ||||||||
WBGene00167341 | ||||||||
Transcript | H04M03.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | H04M03.4.1:c.748-30_910-48del | |||||||
Intron_number | 4-5/8 | |||||||
Exon_number | 5/9 | |||||||
H04M03.70 | ||||||||
H04M03.38 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype (19) | |||||||
Phenotype_not_observed | WBPhenotype:0000103 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. G. Hermann to the National Bioresource Project of Japan: wild-type gut granules. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | GH | |||||||
Reference | WBPaper00035194 | |||||||
Remark | 17190/17191-17560/17561 (370 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |