WormBase Tree Display for Variation: WBVar00251300
expand all nodes | collapse all nodes | view schema
WBVar00251300 | Name | Public_name | tm2412 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | H04M03.4.1:c.748-30_910-48del | |||||||
HGVSg | CHROMOSOME_IV:g.5887932_5888301del | |||||||
Sequence_details | SMap | S_parent | Sequence | H04M03 | ||||
Flanking_sequences | ctttgagttttagtttatttgctggaccgt | caacatgttatttattagttcgatgaaaca | ||||||
Mapping_target | H04M03 | |||||||
Source_location | 7 | CHROMOSOME_IV | 5887931 | 5888302 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2412_external | |||||||
tm2412_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004715 | |||||||
WBStrain00004716 | ||||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2412 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00019154 | ||||||
WBGene00173249 | ||||||||
WBGene00167341 | ||||||||
Transcript | H04M03.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | H04M03.4.1:c.748-30_910-48del | |||||||
Intron_number | 4-5/8 | |||||||
Exon_number | 5/9 | |||||||
H04M03.70 | ||||||||
H04M03.38 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000010 | Paper_evidence | WBPaper00035194 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 worms show almost 20-fold increase in sensitivity to Proteinase K treatment | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000025 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 mutants have superficial blisters | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The overall lethality is markedly accentuated, with 87.5% of tm2412 homozygotes dying during development, either as embryos or as larvae | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Lower levels of lethality were seen in L2 larvae, and later larval stages | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000212 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 mutants displayed a body constriction phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000338 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Swollen post-anal region | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 worms displayed increased hypersensitivity to levamisole | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00035194 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000457 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 mutants displayed poor long-term survival on plates upon starvation | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000586 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 mutants are approximately five-fold more sensitive to alkaline hypochlorite exposure than WTs | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1(tm2412) mutants died within hours after exposure to M. nematophilum | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001209 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 mutant worms exhibited a fully penetrant traction defect when moving on a bacterial lawn or on the agar surface | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001211 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 worms displayed increased permeability to dyes in comparison to WT animals | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001212 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 mutants displayed enhanced cuticle fragility | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001411 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Plant lectins which fail to bind the surface of WT C. elegans stain glf-1 mutants with defective surface coat structures | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001418 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 worms desiccate within seconds when removed from the growth media and appear somewhat shrunken in comparison to WT | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001678 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Loss of glf-1 activity also causes an unusual change in outer surface properties whereby E. coli cells adhere to the worm cuticle | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001856 | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | glf-1 worms displayed increased hypersensitivity to ivermectin | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00035194 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035194 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000103 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. G. Hermann to the National Bioresource Project of Japan: wild-type gut granules. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | GH | |||||||
Reference | WBPaper00035194 | |||||||
Remark | 17190/17191-17560/17561 (370 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |