WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e61 | |||||||
Other_name | e61sd | ||||||||
F27C1.8.1:c.607G>T | |||||||||
CE09720:p.Gly203Ter | |||||||||
HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F27C1 | |||||
Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||||
Mapping_target | F27C1 | ||||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (325) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001067 | |||||||
Transcript | F27C1.8.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F27C1.8.1:c.607G>T | ||||||||
HGVSp | CE09720:p.Gly203Ter | ||||||||
cDNA_position | 607 | ||||||||
CDS_position | 607 | ||||||||
Protein_position | 203 | ||||||||
Exon_number | 1/1 | ||||||||
Codon_change | Gga/Tga | ||||||||
Amino_acid_change | G/* | ||||||||
Interactor | WBInteraction000052055 | ||||||||
WBInteraction000052058 | |||||||||
WBInteraction000501358 | |||||||||
WBInteraction000501364 | |||||||||
WBInteraction000519055 | |||||||||
WBInteraction000537293 | |||||||||
WBInteraction000537294 | |||||||||
Genetics | Interpolated_map_position | I | -0.0011509 | ||||||
Mapping_data | In_2_point (165) | ||||||||
In_multi_point (349) | |||||||||
In_pos_neg_data (72) | |||||||||
Description | Phenotype | WBPhenotype:0000072 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | |||||||
Curator_confirmed | WBPerson3900 | ||||||||
Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "This ability of a mutation in one collagen to affect others was further confirmed for the non-stage-specific collagen DPY-7, after costaining of the TP14:dpy-5(e61)I;kaIs12(col-19::gfp) strain with the DPY-7 monoclonal antibodies (Fig. 3C, red). In the dorsal/ventral hypodermal cells, DPY-7 localized in a regular but constricted pattern that corresponded to the annular furrows (Fig. 3C, denoted an) and was similar to the COL-19::GFP patterns observed in wild-type and in dpy-5 mutants. Conversely, in the matrix overlying the lateral seam cell cords, DPY-7 expression was abnormal: the DPY-7 staining pattern appeared broken (Fig. 3C, denoted by double-headed arrow) and generally deviated from the wildtype staining pattern in which both annuli (COL-19) and annular furrows (DPY-7) normally extend to appose the lateral ala (Fig. 1C)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000583 | Paper_evidence (2) | ||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark | strong dumpy; early larvae non-dumpy; e61/+ is very slightly dumpy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Authors report "strong dpy" (Table 1); "It is interesting to note that the annuli overlying the ventral and dorsal hypodermis are present but differ markedly from wild-type nematodes (Fig. 1E, double-headed arrows) in that they do not oppose the lateral alae (Fig. 3A,E, double-headed arrows). As a result, the cuticle above the lateral hypodermal seam cell cords, having failed to contract normally, is extended, and this results in the characteristic Dpy phenotype." | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In some areas corresponding to the seam cell cords, large vesicles are evident and the tagged protein is found concentrated at the periphery of these structures (Fig. 3D), perhaps indicating a failure in the complete secretion of COL-19::GFP." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000948 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "When the strain TP14:dpy-5(e61) I;kaIs12(col-19::gfp), resulting from crossing TP12:kaIs(col-19::gfp) with the dpy-5(e61) mutant, was examined under epifluorescence, the ala, apparent by means of Nomarski imaging (Fig. 3E), were shown to express COL-19::GFP in a variable manner (Fig. 3B, arrowed). In addition, two distinct regions became apparent: a region overlying the dorsal/ventral hypodermal cells, which showed annuli fluorescing as distinct bands as observed in wildtype TP12:kaIs(col-19::gfp) worms (Fig. 3B-D, denoted an), and a second, extended region of disruption overlying the seam cell cords (Fig. 3B-D, double-headed arrows)... The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)... These data show that mutation of the DPY-5 collagen in these nematodes is sufficient to alter the expression patterns of the COL-19::GFP collagen." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1); "The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1); "The disrupted region did not have the characteristic annuli and instead appeared featureless when viewed by Nomarski microscopy (Fig. 3E, double-headed arrow). The regular annular fluorescence did appear more closely packed than in wildtype nematodes (Fig. 3B-D, denoted an), having a periodicity of approximately 0.75 μm compared with 1.2 μm, respectively, an observation consistent with the shorter length of these adult nematodes." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00053771 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Hypersensitive to the reactive small molecule and prooxidant juglone. | Paper_evidence | WBPaper00053771 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0000071 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutation has no effect on gland morphology | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002176 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (45) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |