WormBase Tree Display for Variation: WBVar00142941
expand all nodes | collapse all nodes | view schema
| WBVar00142941 | Evidence | Paper_evidence | WBPaper00027361 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e61 | |||||||
| Other_name | e61sd | ||||||||
| F27C1.8.1:c.607G>T | |||||||||
| CE09720:p.Gly203Ter | |||||||||
| HGVSg | CHROMOSOME_I:g.5432445C>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F27C1 | |||||
| Flanking_sequences | ccaggacttgctggaccaccaggacgcgat | gacttaccggaaagggacaaccaggagtcg | |||||||
| Mapping_target | F27C1 | ||||||||
| Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00027361 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (325) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001067 | |||||||
| Transcript | F27C1.8.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F27C1.8.1:c.607G>T | ||||||||
| HGVSp | CE09720:p.Gly203Ter | ||||||||
| cDNA_position | 607 | ||||||||
| CDS_position | 607 | ||||||||
| Protein_position | 203 | ||||||||
| Exon_number | 1/1 | ||||||||
| Codon_change | Gga/Tga | ||||||||
| Amino_acid_change | G/* | ||||||||
| Interactor | WBInteraction000052055 | ||||||||
| WBInteraction000052058 | |||||||||
| WBInteraction000501358 | |||||||||
| WBInteraction000501364 | |||||||||
| WBInteraction000519055 | |||||||||
| WBInteraction000537293 | |||||||||
| WBInteraction000537294 | |||||||||
| Genetics | Interpolated_map_position | I | -0.0011509 | ||||||
| Mapping_data | In_2_point (165) | ||||||||
| In_multi_point | 2 | ||||||||
| 3 | |||||||||
| 4 | |||||||||
| 5 | |||||||||
| 6 | |||||||||
| 9 | |||||||||
| 10 | |||||||||
| 11 | |||||||||
| 12 | |||||||||
| 13 | |||||||||
| 14 | |||||||||
| 15 | |||||||||
| 17 | |||||||||
| 20 | |||||||||
| 21 | |||||||||
| 22 | |||||||||
| 23 | |||||||||
| 24 | |||||||||
| 27 | |||||||||
| 30 | |||||||||
| 31 | |||||||||
| 32 | |||||||||
| 33 | |||||||||
| 34 | |||||||||
| 35 | |||||||||
| 36 | |||||||||
| 37 | |||||||||
| 42 | |||||||||
| 43 | |||||||||
| 44 | |||||||||
| 197 | |||||||||
| 198 | |||||||||
| 199 | |||||||||
| 200 | |||||||||
| 201 | |||||||||
| 202 | |||||||||
| 204 | |||||||||
| 205 | |||||||||
| 231 | |||||||||
| 232 | |||||||||
| 233 | |||||||||
| 234 | |||||||||
| 235 | |||||||||
| 236 | |||||||||
| 238 | |||||||||
| 239 | |||||||||
| 240 | |||||||||
| 241 | |||||||||
| 243 | |||||||||
| 244 | |||||||||
| 245 | |||||||||
| 248 | |||||||||
| 250 | |||||||||
| 270 | |||||||||
| 271 | |||||||||
| 272 | |||||||||
| 289 | |||||||||
| 306 | |||||||||
| 308 | |||||||||
| 309 | |||||||||
| 310 | |||||||||
| 311 | |||||||||
| 312 | |||||||||
| 327 | |||||||||
| 328 | |||||||||
| 335 | |||||||||
| 336 | |||||||||
| 343 | |||||||||
| 344 | |||||||||
| 350 | |||||||||
| 360 | |||||||||
| 361 | |||||||||
| 364 | |||||||||
| 365 | |||||||||
| 372 | |||||||||
| 373 | |||||||||
| 380 | |||||||||
| 381 | |||||||||
| 391 | |||||||||
| 396 | |||||||||
| 397 | |||||||||
| 398 | |||||||||
| 399 | |||||||||
| 400 | |||||||||
| 401 | |||||||||
| 402 | |||||||||
| 403 | |||||||||
| 414 | |||||||||
| 420 | |||||||||
| 452 | |||||||||
| 454 | |||||||||
| 499 | |||||||||
| 505 | |||||||||
| 510 | |||||||||
| 511 | |||||||||
| 512 | |||||||||
| 515 | |||||||||
| 517 | |||||||||
| 518 | |||||||||
| 527 | |||||||||
| 538 | |||||||||
| 566 | |||||||||
| 567 | |||||||||
| 572 | |||||||||
| 573 | |||||||||
| 574 | |||||||||
| 575 | |||||||||
| 576 | |||||||||
| 604 | |||||||||
| 634 | |||||||||
| 635 | |||||||||
| 636 | |||||||||
| 637 | |||||||||
| 638 | |||||||||
| 639 | |||||||||
| 640 | |||||||||
| 693 | |||||||||
| 694 | |||||||||
| 696 | |||||||||
| 697 | |||||||||
| 719 | |||||||||
| 720 | |||||||||
| 734 | |||||||||
| 813 | |||||||||
| 815 | |||||||||
| 958 | |||||||||
| 959 | |||||||||
| 963 | |||||||||
| 964 | |||||||||
| 965 | |||||||||
| 966 | |||||||||
| 967 | |||||||||
| 968 | |||||||||
| 969 | |||||||||
| 970 | |||||||||
| 973 | |||||||||
| 974 | |||||||||
| 977 | |||||||||
| 980 | |||||||||
| 983 | |||||||||
| 985 | |||||||||
| 986 | |||||||||
| 988 | |||||||||
| 989 | |||||||||
| 990 | |||||||||
| 991 | |||||||||
| 992 | |||||||||
| 997 | |||||||||
| 998 | |||||||||
| 1004 | |||||||||
| 1005 | |||||||||
| 1006 | |||||||||
| 1007 | |||||||||
| 1008 | |||||||||
| 1009 | |||||||||
| 1010 | |||||||||
| 1011 | |||||||||
| 1012 | |||||||||
| 1013 | |||||||||
| 1014 | |||||||||
| 1015 | |||||||||
| 1016 | |||||||||
| 1017 | |||||||||
| 1018 | |||||||||
| 1019 | |||||||||
| 1020 | |||||||||
| 1021 | |||||||||
| 1022 | |||||||||
| 1023 | |||||||||
| 1024 | |||||||||
| 1025 | |||||||||
| 1026 | |||||||||
| 1027 | |||||||||
| 1028 | |||||||||
| 1029 | |||||||||
| 1030 | |||||||||
| 1031 | |||||||||
| 1032 | |||||||||
| 1033 | |||||||||
| 1034 | |||||||||
| 1035 | |||||||||
| 1036 | |||||||||
| 1037 | |||||||||
| 1038 | |||||||||
| 1039 | |||||||||
| 1040 | |||||||||
| 1041 | |||||||||
| 1042 | |||||||||
| 1043 | |||||||||
| 1044 | |||||||||
| 1045 | |||||||||
| 1046 | |||||||||
| 1047 | |||||||||
| 1048 | |||||||||
| 1049 | |||||||||
| 1050 | |||||||||
| 1051 | |||||||||
| 1064 | |||||||||
| 1219 | |||||||||
| 1222 | |||||||||
| 1224 | |||||||||
| 1225 | |||||||||
| 1226 | |||||||||
| 1230 | |||||||||
| 1288 | |||||||||
| 1289 | |||||||||
| 1290 | |||||||||
| 1291 | |||||||||
| 1293 | |||||||||
| 1370 | |||||||||
| 1371 | |||||||||
| 1374 | |||||||||
| 1376 | |||||||||
| 1386 | |||||||||
| 1445 | |||||||||
| 1446 | |||||||||
| 1448 | |||||||||
| 1450 | |||||||||
| 1453 | |||||||||
| 1454 | |||||||||
| 1456 | |||||||||
| 1461 | |||||||||
| 1465 | |||||||||
| 1479 | |||||||||
| 1480 | |||||||||
| 1481 | |||||||||
| 1678 | |||||||||
| 1679 | |||||||||
| 1680 | |||||||||
| 1682 | |||||||||
| 1683 | |||||||||
| 1684 | |||||||||
| 1685 | |||||||||
| 1686 | |||||||||
| 1687 | |||||||||
| 1689 | |||||||||
| 1690 | |||||||||
| 1695 | |||||||||
| 1698 | |||||||||
| 1759 | |||||||||
| 1761 | |||||||||
| 1763 | |||||||||
| 1782 | |||||||||
| 1783 | |||||||||
| 1787 | |||||||||
| 1788 | |||||||||
| 1825 | |||||||||
| 1826 | |||||||||
| 1828 | |||||||||
| 1871 | |||||||||
| 1891 | |||||||||
| 1896 | |||||||||
| 1897 | |||||||||
| 1902 | |||||||||
| 2001 | |||||||||
| 2034 | |||||||||
| 2040 | |||||||||
| 2041 | |||||||||
| 2091 | |||||||||
| 2092 | |||||||||
| 2093 | |||||||||
| 2094 | |||||||||
| 2095 | |||||||||
| 2096 | |||||||||
| 2097 | |||||||||
| 2131 | |||||||||
| 2139 | |||||||||
| 2141 | |||||||||
| 2142 | |||||||||
| 2143 | |||||||||
| 2144 | |||||||||
| 2145 | |||||||||
| 2146 | |||||||||
| 2147 | |||||||||
| 2148 | |||||||||
| 2149 | |||||||||
| 2150 | |||||||||
| 2218 | |||||||||
| 2220 | |||||||||
| 2278 | |||||||||
| 2279 | |||||||||
| 2280 | |||||||||
| 2285 | |||||||||
| 2330 | |||||||||
| 2332 | |||||||||
| 2333 | |||||||||
| 2410 | |||||||||
| 2426 | |||||||||
| 2427 | |||||||||
| 2444 | |||||||||
| 2447 | |||||||||
| 2456 | |||||||||
| 2457 | |||||||||
| 2466 | |||||||||
| 2477 | |||||||||
| 2710 | |||||||||
| 2767 | |||||||||
| 2768 | |||||||||
| 2769 | |||||||||
| 2784 | |||||||||
| 3000 | |||||||||
| 3001 | |||||||||
| 3002 | |||||||||
| 3003 | |||||||||
| 3008 | |||||||||
| 3010 | |||||||||
| 3020 | |||||||||
| 3021 | |||||||||
| 3022 | |||||||||
| 3030 | |||||||||
| 3035 | |||||||||
| 3036 | |||||||||
| 3037 | |||||||||
| 3038 | |||||||||
| 3039 | |||||||||
| 3040 | |||||||||
| 3042 | |||||||||
| 3043 | |||||||||
| 3044 | |||||||||
| 3046 | |||||||||
| 3105 | |||||||||
| 3106 | |||||||||
| 3107 | |||||||||
| 3115 | |||||||||
| 3116 | |||||||||
| 3117 | |||||||||
| 3118 | |||||||||
| 3119 | |||||||||
| 3143 | |||||||||
| 3144 | |||||||||
| 3193 | |||||||||
| 3194 | |||||||||
| 3227 | |||||||||
| 3230 | |||||||||
| 3234 | |||||||||
| 3254 | |||||||||
| 3307 | |||||||||
| 3308 | |||||||||
| 3309 | |||||||||
| 3310 | |||||||||
| 3311 | |||||||||
| 3375 | |||||||||
| 3380 | |||||||||
| 3434 | |||||||||
| 3435 | |||||||||
| 3436 | |||||||||
| 5458 | |||||||||
| 5459 | |||||||||
| 5471 | |||||||||
| In_pos_neg_data (72) | |||||||||
| Description | Phenotype | WBPhenotype:0000072 | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | |||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | ||||||
| Curator_confirmed | WBPerson3900 | ||||||||
| Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | |||||
| Curator_confirmed | WBPerson3900 | ||||||||
| WBPhenotype:0000424 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "This ability of a mutation in one collagen to affect others was further confirmed for the non-stage-specific collagen DPY-7, after costaining of the TP14:dpy-5(e61)I;kaIs12(col-19::gfp) strain with the DPY-7 monoclonal antibodies (Fig. 3C, red). In the dorsal/ventral hypodermal cells, DPY-7 localized in a regular but constricted pattern that corresponded to the annular furrows (Fig. 3C, denoted an) and was similar to the COL-19::GFP patterns observed in wild-type and in dpy-5 mutants. Conversely, in the matrix overlying the lateral seam cell cords, DPY-7 expression was abnormal: the DPY-7 staining pattern appeared broken (Fig. 3C, denoted by double-headed arrow) and generally deviated from the wildtype staining pattern in which both annuli (COL-19) and annular furrows (DPY-7) normally extend to appose the lateral ala (Fig. 1C)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | |||||||
| WBPaper00005747 | |||||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPerson712 | |||||||||
| WBPerson2987 | |||||||||
| Remark | strong dumpy; early larvae non-dumpy; e61/+ is very slightly dumpy | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Authors report "strong dpy" (Table 1); "It is interesting to note that the annuli overlying the ventral and dorsal hypodermis are present but differ markedly from wild-type nematodes (Fig. 1E, double-headed arrows) in that they do not oppose the lateral alae (Fig. 3A,E, double-headed arrows). As a result, the cuticle above the lateral hypodermal seam cell cords, having failed to contract normally, is extended, and this results in the characteristic Dpy phenotype." | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Semi_dominant | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000679 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "In some areas corresponding to the seam cell cords, large vesicles are evident and the tagged protein is found concentrated at the periphery of these structures (Fig. 3D), perhaps indicating a failure in the complete secretion of COL-19::GFP." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000948 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "When the strain TP14:dpy-5(e61) I;kaIs12(col-19::gfp), resulting from crossing TP12:kaIs(col-19::gfp) with the dpy-5(e61) mutant, was examined under epifluorescence, the ala, apparent by means of Nomarski imaging (Fig. 3E), were shown to express COL-19::GFP in a variable manner (Fig. 3B, arrowed). In addition, two distinct regions became apparent: a region overlying the dorsal/ventral hypodermal cells, which showed annuli fluorescing as distinct bands as observed in wildtype TP12:kaIs(col-19::gfp) worms (Fig. 3B-D, denoted an), and a second, extended region of disruption overlying the seam cell cords (Fig. 3B-D, double-headed arrows)... The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)... These data show that mutation of the DPY-5 collagen in these nematodes is sufficient to alter the expression patterns of the COL-19::GFP collagen." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Authors report "multiple or discontinuous ala" (Table 1); "The region of dominant COL-19::GFP mutant expression and disruption overlying the lateral seam cell hypodermis has a complex fibrous and broken appearance (Fig. 3B-D, double-headed arrows)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1); "The disrupted region did not have the characteristic annuli and instead appeared featureless when viewed by Nomarski microscopy (Fig. 3E, double-headed arrow). The regular annular fluorescence did appear more closely packed than in wildtype nematodes (Fig. 3B-D, denoted an), having a periodicity of approximately 0.75 μm compared with 1.2 μm, respectively, an observation consistent with the shorter length of these adult nematodes." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001621 | Paper_evidence | WBPaper00053771 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | Hypersensitive to the reactive small molecule and prooxidant juglone. | Paper_evidence | WBPaper00053771 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000071 | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Scanning electron micrograph (SEM) analysis of this strain revealed that dpy-5 mutant nematodes have a relatively normal head morphology; however, the mid-body and tail regions were markedly shorter and fatter than their wild-type counterparts (Fig. 3A)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | mutation has no effect on gland morphology | Paper_evidence | WBPaper00040002 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0002176 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "By using a hypodermal junction-specific monoclonal antibody, MH27 (Francis and Waterston, 1985), we were able to confirm that the hypodermal seam cells were relatively normal in dpy-5(e61) mutant nematodes, whereas the overlying cuticle was abnormal (supplementary Fig. II, F, available online at www.interscience.wiley.com/developmentaldynamics/suppmat/index.html)." | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference (45) | |||||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
| Method | Substitution_allele |
