WormBase Tree Display for Variation: WBVar00142938
expand all nodes | collapse all nodes | view schema
WBVar00142938 | Evidence | Paper_evidence | WBPaper00006005 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e55 | |||||||
Other_name (30) | |||||||||
HGVSg | CHROMOSOME_X:g.2723343G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T02C5 | |||||
Flanking_sequences | agacggcgagccgctaataaaaagttaaaa | aagcctcaaaacagcagtctacagaaactg | |||||||
Mapping_target | T02C5 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006005 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (14) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006742 | |||||||
Transcript (15) | |||||||||
Interactor | WBInteraction000052099 | ||||||||
WBInteraction000052101 | |||||||||
WBInteraction000501477 | |||||||||
WBInteraction000501479 | |||||||||
WBInteraction000502185 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | X | -13.8024 | ||||||
Mapping_data | In_2_point | 154 | |||||||
3151 | |||||||||
In_multi_point (14) | |||||||||
In_pos_neg_data (18) | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Paper_evidence | WBPaper00001709 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | weak kinker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000005 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00001709 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000020 | Paper_evidence | WBPaper00001709 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000023 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | hypersensitive to serotonin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000536 | Paper_evidence | WBPaper00039865 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Cultured CEPsh glial cells from mutant worms exhibit altered intracellular calcium-based responses to depolarization. | Paper_evidence | WBPaper00039865 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000556 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Fails to desensitize to dopamine. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004583 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000616 | Paper_evidence | WBPaper00042396 | |||||||
Curator_confirmed | WBPerson1687 | ||||||||
Remark | GABAergic neuromuscular junctions (NMJs) are enlarged | Paper_evidence | WBPaper00042396 | ||||||
Curator_confirmed | WBPerson1687 | ||||||||
Recessive | Paper_evidence | WBPaper00042396 | |||||||
Curator_confirmed | WBPerson1687 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00042396 | ||||||
Curator_confirmed | WBPerson1687 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00042396 | ||||
Curator_confirmed | WBPerson1687 | ||||||||
GO_term | GO:0050808 | PATO:0000460 | Paper_evidence | WBPaper00042396 | |||||
Curator_confirmed | WBPerson1687 | ||||||||
GO:0045202 | PATO:0000460 | Paper_evidence | WBPaper00042396 | ||||||
Curator_confirmed | WBPerson1687 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000650 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001410 | Paper_evidence | WBPaper00003955 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No staining of activated MAP kinase was observed, even in after odorant stimulus, whereas immunoreactivity against the anti-activated-MAPK antibody was observed in the AWC neurons (and others) after 10 seconds of application with isoamylalcohol. | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001512 | Paper_evidence | WBPaper00029404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals express str-2::GFP in both AWC cells, e.g. both AWC neurons are AWC on , whereas other animals have AWC symmetry similar to wild-type and a few animals have are 2 AWC off (n=103). | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005832 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005833 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | str-2::GFP | Paper_evidence | WBPaper00029404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
WBPaper00039901 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Mutants are defective in str-2 asymmetry | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Loss-of-function mutants showed a 2AWC-ON phenotype resembling that caused by nocodazole treatment. | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003760 | ||||||
WBPaper00039901 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
WBPaper00039901 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed (4) | |||||||||
Reference (21) | |||||||||
Remark | Resequencing of e55 places the lesion at Q(458) (in isoform T02C5.5b) with flanks of agacggcgagccgctaataaaaagttaaaa & aagcctcaaaacagcagtctacagaaactg | Person_evidence | WBPerson12335 | ||||||
Laboratory_evidence | KG | ||||||||
Following genotyping from the CGC we are updating the flanking sequences to follow both the reported update from 2011 and those now supplied by the CGC. Old flanks [tgttgccattcagttggaaaattcatcaaa aactgaggtaagaataaataatagtgtttt]. | Person_evidence | WBPerson2207 | |||||||
Curator_confirmed | WBPerson1983 | ||||||||
Method | Substitution_allele |