WormBase Tree Display for Variation: WBVar00142938
expand all nodes | collapse all nodes | view schema
WBVar00142938 | Evidence | Paper_evidence | WBPaper00006005 | |
---|---|---|---|---|
Name | Public_name | e55 | ||
Other_name (30) | ||||
HGVSg | CHROMOSOME_X:g.2723343G>A | |||
Sequence_details (5) | ||||
Variation_type | Allele | |||
Origin | Species | Caenorhabditis elegans | ||
Strain (14) | ||||
Laboratory | CB | |||
Status | Live | |||
Affects | Gene | WBGene00006742 | ||
Transcript (15) | ||||
Interactor | WBInteraction000052099 | |||
WBInteraction000052101 | ||||
WBInteraction000501477 | ||||
WBInteraction000501479 | ||||
WBInteraction000502185 | ||||
Isolation | Mutagen | EMS | ||
Genetics | Interpolated_map_position | X | -13.8024 | |
Mapping_data | In_2_point | 154 | ||
3151 | ||||
In_multi_point (14) | ||||
In_pos_neg_data (18) | ||||
Description | Phenotype (16) | |||
Phenotype_not_observed (4) | ||||
Reference (21) | ||||
Remark | Resequencing of e55 places the lesion at Q(458) (in isoform T02C5.5b) with flanks of agacggcgagccgctaataaaaagttaaaa & aagcctcaaaacagcagtctacagaaactg | Person_evidence | WBPerson12335 | |
Laboratory_evidence | KG | |||
Following genotyping from the CGC we are updating the flanking sequences to follow both the reported update from 2011 and those now supplied by the CGC. Old flanks [tgttgccattcagttggaaaattcatcaaa aactgaggtaagaataaataatagtgtttt]. | Person_evidence | WBPerson2207 | ||
Curator_confirmed | WBPerson1983 | |||
Method | Substitution_allele |