WormBase Tree Display for Variation: WBVar00142938

WBVar00142938 Evidence: Paper_evidence: WBPaper00006005
  Name: Public_name: e55
    Other_name (30)
    HGVSg: CHROMOSOME_X:g.2723343G>A
  Sequence_details: SMap: S_parent: Sequence: T02C5
    Flanking_sequences: agacggcgagccgctaataaaaagttaaaa aagcctcaaaacagcagtctacagaaactg
    Mapping_target: T02C5
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00006005
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (14)
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006742
    Transcript: T02C5.5g.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5g.1:c.1462C>T
        HGVSp: CE51886:p.Gln488Ter
        cDNA_position: 1462
        CDS_position: 1462
        Protein_position: 488
        Exon_number: 8/29
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5q.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5q.1:c.1246C>T
        HGVSp: CE52709:p.Gln416Ter
        cDNA_position: 1246
        CDS_position: 1246
        Protein_position: 416
        Exon_number: 8/28
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5j.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5j.1:c.1267C>T
        HGVSp: CE51856:p.Gln423Ter
        cDNA_position: 1267
        CDS_position: 1267
        Protein_position: 423
        Exon_number: 8/29
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5o.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5o.1:c.1648C>T
        HGVSp: CE52764:p.Gln550Ter
        cDNA_position: 1648
        CDS_position: 1648
        Protein_position: 550
        Exon_number: 12/32
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5f.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5f.1:c.1462C>T
        HGVSp: CE51879:p.Gln488Ter
        cDNA_position: 1462
        CDS_position: 1462
        Protein_position: 488
        Exon_number: 8/30
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5h.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5h.1:c.1462C>T
        HGVSp: CE51907:p.Gln488Ter
        cDNA_position: 1462
        CDS_position: 1462
        Protein_position: 488
        Exon_number: 8/29
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5c.1:c.994C>T
        HGVSp: CE51899:p.Gln332Ter
        cDNA_position: 994
        CDS_position: 994
        Protein_position: 332
        Exon_number: 6/28
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5p.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5p.1:c.1804C>T
        HGVSp: CE52692:p.Gln602Ter
        cDNA_position: 1804
        CDS_position: 1804
        Protein_position: 602
        Exon_number: 14/34
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5k.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5k.1:c.1267C>T
        HGVSp: CE51839:p.Gln423Ter
        cDNA_position: 1267
        CDS_position: 1267
        Protein_position: 423
        Exon_number: 8/28
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5m.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5m.1:c.1267C>T
        HGVSp: CE51867:p.Gln423Ter
        cDNA_position: 1267
        CDS_position: 1267
        Protein_position: 423
        Exon_number: 8/28
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5l.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5l.1:c.1267C>T
        HGVSp: CE51857:p.Gln423Ter
        cDNA_position: 1267
        CDS_position: 1267
        Protein_position: 423
        Exon_number: 8/29
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5a.1:c.994C>T
        HGVSp: CE51900:p.Gln332Ter
        cDNA_position: 994
        CDS_position: 994
        Protein_position: 332
        Exon_number: 6/21
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5n.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5n.1:c.1672C>T
        HGVSp: CE52755:p.Gln558Ter
        cDNA_position: 1672
        CDS_position: 1672
        Protein_position: 558
        Exon_number: 12/32
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5i.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5i.1:c.1462C>T
        HGVSp: CE51840:p.Gln488Ter
        cDNA_position: 1462
        CDS_position: 1462
        Protein_position: 488
        Exon_number: 8/28
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      T02C5.5b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T02C5.5b.1:c.1372C>T
        HGVSp: CE34980:p.Gln458Ter
        cDNA_position: 1428
        CDS_position: 1372
        Protein_position: 458
        Exon_number: 9/30
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor: WBInteraction000052099
      WBInteraction000052101
      WBInteraction000501477
      WBInteraction000501479
      WBInteraction000502185
  Isolation: Mutagen: EMS
  Genetics: Interpolated_map_position: X -13.8024
    Mapping_data: In_2_point: 154
        3151
      In_multi_point (14)
      In_pos_neg_data (18)
  Description: Phenotype (16)
    Phenotype_not_observed: WBPhenotype:0001182 Paper_evidence: WBPaper00031915
        Curator_confirmed: WBPerson2021
        Remark: Mutants had wild-type fat content Paper_evidence: WBPaper00031915
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Fat content was visualized by Nile red staining Paper_evidence: WBPaper00031915
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001645 Paper_evidence: WBPaper00040284
        Curator_confirmed: WBPerson2987
        Remark: Table S2 Paper_evidence: WBPaper00040284
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001660 Paper_evidence: WBPaper00006052
        Curator_confirmed: WBPerson2021
        Remark: No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) Paper_evidence: WBPaper00006052
            Curator_confirmed: WBPerson2021
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00006052
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: otIs114, otIs6, otIs3 Paper_evidence: WBPaper00006052
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001811 Paper_evidence: WBPaper00031915
        Curator_confirmed: WBPerson2021
        Remark: Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin Paper_evidence: WBPaper00031915
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining Paper_evidence: WBPaper00031915
              Curator_confirmed: WBPerson2021
  Reference (21)
  Remark: Resequencing of e55 places the lesion at Q(458) (in isoform T02C5.5b) with flanks of agacggcgagccgctaataaaaagttaaaa & aagcctcaaaacagcagtctacagaaactg Person_evidence: WBPerson12335
      Laboratory_evidence: KG
    Following genotyping from the CGC we are updating the flanking sequences to follow both the reported update from 2011 and those now supplied by the CGC. Old flanks [tgttgccattcagttggaaaattcatcaaa aactgaggtaagaataaataatagtgtttt]. Person_evidence: WBPerson2207
      Curator_confirmed: WBPerson1983
  Method: Substitution_allele