WormBase Tree Display for Variation: WBVar00142938
expand all nodes | collapse all nodes | view schema
WBVar00142938 | Evidence | Paper_evidence | WBPaper00006005 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e55 | ||||||
Other_name (30) | ||||||||
HGVSg | CHROMOSOME_X:g.2723343G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | T02C5 | ||||
Flanking_sequences | agacggcgagccgctaataaaaagttaaaa | aagcctcaaaacagcagtctacagaaactg | ||||||
Mapping_target | T02C5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006005 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (14) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006742 | ||||||
Transcript (15) | ||||||||
Interactor | WBInteraction000052099 | |||||||
WBInteraction000052101 | ||||||||
WBInteraction000501477 | ||||||||
WBInteraction000501479 | ||||||||
WBInteraction000502185 | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | -13.8024 | |||||
Mapping_data | In_2_point | 154 | ||||||
3151 | ||||||||
In_multi_point (14) | ||||||||
In_pos_neg_data | 1863 | |||||||
1870 | ||||||||
1884 | ||||||||
1908 | ||||||||
1924 | ||||||||
1940 | ||||||||
1956 | ||||||||
1972 | ||||||||
1988 | ||||||||
2025 | ||||||||
2038 | ||||||||
2054 | ||||||||
2061 | ||||||||
5050 | ||||||||
5060 | ||||||||
5449 | ||||||||
5460 | ||||||||
5836 | ||||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants had wild-type fat content | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Fat content was visualized by Nile red staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001811 | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (21) | ||||||||
Remark | Resequencing of e55 places the lesion at Q(458) (in isoform T02C5.5b) with flanks of agacggcgagccgctaataaaaagttaaaa & aagcctcaaaacagcagtctacagaaactg | Person_evidence | WBPerson12335 | |||||
Laboratory_evidence | KG | |||||||
Following genotyping from the CGC we are updating the flanking sequences to follow both the reported update from 2011 and those now supplied by the CGC. Old flanks [tgttgccattcagttggaaaattcatcaaa aactgaggtaagaataaataatagtgtttt]. | Person_evidence | WBPerson2207 | ||||||
Curator_confirmed | WBPerson1983 | |||||||
Method | Substitution_allele |