WormBase Tree Display for Variation: WBVar00090496
expand all nodes | collapse all nodes | view schema
| WBVar00090496 | Evidence | Paper_evidence | WBPaper00002911 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n2476 | |||||
| Other_name | CE25119:p.Thr175TyrfsTer2 | ||||||
| T20G5.6.1:c.520_631del | |||||||
| HGVSg | CHROMOSOME_III:g.10185074_10185283del | ||||||
| Sequence_details | SMap | S_parent | Sequence | T20G5 | |||
| Flanking_sequences | ggattcggaaaatgggttcttgctgcacaa | ctttactaacgtgctcatttcttgatgatct | |||||
| Mapping_target | T20G5 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006783 | |||||
| Transcript | T20G5.6.1 (11) | ||||||
| Interactor | WBInteraction000502941 | ||||||
| Isolation | Mutagen | EMS | |||||
| Genetics | Interpolated_map_position | III | 2.00209 | ||||
| Description | Phenotype | WBPhenotype:0000655 | Paper_evidence | WBPaper00002911 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Null | Paper_evidence | WBPaper00002911 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00002911 | ||||||
| Remark | n2476 is a 238-base-pair deletion that removes parts of exons three and four. This deletion causes a frameshift at residue 175 and the ORF terminates after another 115 amino acids, indicating that this allele is a molecular null. | ||||||
| Method | Deletion_allele |
