WormBase Tree Display for Variation: WBVar00090496
expand all nodes | collapse all nodes | view schema
WBVar00090496 | Evidence | Paper_evidence | WBPaper00002911 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n2476 | |||||
Other_name (2) | |||||||
HGVSg | CHROMOSOME_III:g.10185074_10185283del | ||||||
Sequence_details | SMap | S_parent | Sequence | T20G5 | |||
Flanking_sequences | ggattcggaaaatgggttcttgctgcacaa | ctttactaacgtgctcatttcttgatgatct | |||||
Mapping_target | T20G5 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006783 | |||||
Transcript | T20G5.6.1 (11) | ||||||
Interactor | WBInteraction000502941 | ||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | III | 2.00209 | ||||
Description | Phenotype | WBPhenotype:0000655 | Paper_evidence | WBPaper00002911 | |||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00002911 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00002911 | ||||||
Remark | n2476 is a 238-base-pair deletion that removes parts of exons three and four. This deletion causes a frameshift at residue 175 and the ORF terminates after another 115 amino acids, indicating that this allele is a molecular null. | ||||||
Method | Deletion_allele |