WormBase Tree Display for Variation: WBVar00090496
expand all nodes | collapse all nodes | view schema
WBVar00090496 | Evidence | Paper_evidence | WBPaper00002911 | ||
---|---|---|---|---|---|
Name | Public_name | n2476 | |||
Other_name | CE25119:p.Thr175TyrfsTer2 | ||||
T20G5.6.1:c.520_631del | |||||
HGVSg | CHROMOSOME_III:g.10185074_10185283del | ||||
Sequence_details | SMap | S_parent | Sequence | T20G5 | |
Flanking_sequences | ggattcggaaaatgggttcttgctgcacaa | ctttactaacgtgctcatttcttgatgatct | |||
Mapping_target | T20G5 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Laboratory | MT | ||||
Status | Live | ||||
Affects | Gene | WBGene00006783 | |||
Transcript | T20G5.6.1 (11) | ||||
Interactor | WBInteraction000502941 | ||||
Isolation | Mutagen | EMS | |||
Genetics | Interpolated_map_position | III | 2.00209 | ||
Description | Phenotype | WBPhenotype:0000655 | Paper_evidence | WBPaper00002911 | |
Curator_confirmed | WBPerson712 | ||||
Variation_effect | Null (2) | ||||
Reference | WBPaper00002911 | ||||
Remark | n2476 is a 238-base-pair deletion that removes parts of exons three and four. This deletion causes a frameshift at residue 175 and the ORF terminates after another 115 amino acids, indicating that this allele is a molecular null. | ||||
Method | Deletion_allele |