WormBase Tree Display for Variation: WBVar00088448
expand all nodes | collapse all nodes | view schema
WBVar00088448 | Evidence | Paper_evidence | WBPaper00004669 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky400 | |||||||
Other_name | F59A6.1b.1:c.1582A>T | ||||||||
CE50862:p.Lys528Ter | |||||||||
CE44901:p.Lys542Ter | |||||||||
F59A6.1a.1:c.1624A>T | |||||||||
HGVSg | CHROMOSOME_II:g.5026025A>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F33G12 | |||||
Flanking_sequences | agatacccagtacttattctggaactcaat | aggaattcacaccttcttatctgactctga | |||||||
Mapping_target | F33G12 | ||||||||
Type_of_mutation | Substitution | a | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003822 | |||||||
Transcript | F59A6.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F59A6.1a.1:c.1624A>T | ||||||||
HGVSp | CE44901:p.Lys542Ter | ||||||||
cDNA_position | 1781 | ||||||||
CDS_position | 1624 | ||||||||
Protein_position | 542 | ||||||||
Exon_number | 7/12 | ||||||||
Codon_change | Aag/Tag | ||||||||
Amino_acid_change | K/* | ||||||||
F59A6.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F59A6.1b.1:c.1582A>T | ||||||||
HGVSp | CE50862:p.Lys528Ter | ||||||||
cDNA_position | 1582 | ||||||||
CDS_position | 1582 | ||||||||
Protein_position | 528 | ||||||||
Exon_number | 6/11 | ||||||||
Codon_change | Aag/Tag | ||||||||
Amino_acid_change | K/* | ||||||||
Interactor | WBInteraction000501729 | ||||||||
WBInteraction000504796 | |||||||||
WBInteraction000517982 | |||||||||
WBInteraction000517983 | |||||||||
Genetics | Interpolated_map_position | II | -2.59273 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00003760 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | nsy-1 mutants are egg-laying defective | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000067 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had a lower survival rate in the presence of stress-inducing drugs. | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00037959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004565 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004592 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001095 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had a lower survival rate in the presence of stress-inducing conditions. | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00037959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Anoxia induced PMK-1 activation was suppressed in nsy-1 mutant. | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005312 | Paper_evidence | WBPaper00037959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001381 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | nsy-1(ky400) mutant animals showed a higher survival rate than the wild-type ones under anoxic conditions. | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 2 AWC on | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000424 | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The total amount of PMK-1 was assessed by an anti-PMK-1 antibody, and little difference was observed between the wild-type and nsy-1(ky400) mutant animals under the basal and stimulated conditions. | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005312 | Paper_evidence | WBPaper00037959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | nsy-1(ky400) mutant animals showed almost the same survival curve as wild-type animals under non-stressed conditions, as in the presence of 5-fluoro-2'-deoxyuridine. | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | nsy-1 mutants are coordinated | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00037959 | ||||||||
WBPaper00003760 | |||||||||
WBPaper00004669 | |||||||||
Method | Substitution_allele |