WormBase Tree Display for Variation: WBVar00088387
expand all nodes | collapse all nodes | view schema
| WBVar00088387 | Evidence | Paper_evidence | WBPaper00002930 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ky10 | |||||
| Other_name | B0212.5.1:c.517C>T | ||||||
| CE20445:p.Gln173Ter | |||||||
| HGVSg | CHROMOSOME_IV:g.3556045G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | B0212 | |||
| Flanking_sequences | GCGGCCTGAAACATTGTGTTATCTTTAGGC | AATCAGCCCTCCACCTAGCCATTGTACACG | |||||
| Mapping_target | B0212 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002930 | ||
| Person_evidence | WBPerson40923 | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00005214 | ||||||
| WBStrain00007483 | |||||||
| WBStrain00052609 | |||||||
| Laboratory | CX | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003889 | |||||
| Transcript | B0212.5.1 | VEP_consequence | stop_gained,splice_region_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | B0212.5.1:c.517C>T | ||||||
| HGVSp | CE20445:p.Gln173Ter | ||||||
| cDNA_position | 517 | ||||||
| CDS_position | 517 | ||||||
| Protein_position | 173 | ||||||
| Exon_number | 5/15 | ||||||
| Codon_change | Caa/Taa | ||||||
| Amino_acid_change | Q/* | ||||||
| Interactor (17) | |||||||
| Genetics | Interpolated_map_position | IV | -3.15548 | ||||
| Description | Phenotype (34) | ||||||
| Phenotype_not_observed (19) | |||||||
| Reference (25) | |||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003889 Ochre_UAA Q(173) to stop | Paper_evidence | WBPaper00002930 | ||||
| Method | Substitution_allele |
