WormBase Tree Display for Variation: WBVar00088387
expand all nodes | collapse all nodes | view schema
WBVar00088387 | Evidence | Paper_evidence | WBPaper00002930 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ky10 | |||||
Other_name | B0212.5.1:c.517C>T | ||||||
CE20445:p.Gln173Ter | |||||||
HGVSg | CHROMOSOME_IV:g.3556045G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | B0212 | |||
Flanking_sequences | GCGGCCTGAAACATTGTGTTATCTTTAGGC | AATCAGCCCTCCACCTAGCCATTGTACACG | |||||
Mapping_target | B0212 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002930 | ||
Person_evidence | WBPerson40923 | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00005214 | ||||||
WBStrain00007483 | |||||||
WBStrain00052609 | |||||||
Laboratory | CX | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003889 | |||||
Transcript | B0212.5.1 | VEP_consequence | stop_gained,splice_region_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | B0212.5.1:c.517C>T | ||||||
HGVSp | CE20445:p.Gln173Ter | ||||||
cDNA_position | 517 | ||||||
CDS_position | 517 | ||||||
Protein_position | 173 | ||||||
Exon_number | 5/15 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
Interactor (17) | |||||||
Genetics | Interpolated_map_position | IV | -3.15548 | ||||
Description | Phenotype (34) | ||||||
Phenotype_not_observed (19) | |||||||
Reference | WBPaper00002930 | ||||||
WBPaper00038142 | |||||||
WBPaper00043908 | |||||||
WBPaper00031936 | |||||||
WBPaper00031935 | |||||||
WBPaper00029060 | |||||||
WBPaper00032000 | |||||||
WBPaper00023490 | |||||||
WBPaper00005150 | |||||||
WBPaper00017785 | |||||||
WBPaper00019186 | |||||||
WBPaper00032215 | |||||||
WBPaper00035961 | |||||||
WBPaper00037771 | |||||||
WBPaper00043891 | |||||||
WBPaper00048410 | |||||||
WBPaper00059397 | |||||||
WBPaper00059946 | |||||||
WBPaper00060627 | |||||||
WBPaper00045595 | |||||||
WBPaper00061840 | |||||||
WBPaper00061945 | |||||||
WBPaper00064938 | |||||||
WBPaper00064927 | |||||||
WBPaper00065019 | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003889 Ochre_UAA Q(173) to stop | Paper_evidence | WBPaper00002930 | ||||
Method | Substitution_allele |