WormBase Tree Display for Variation: WBVar00088385

WBVar00088385 Evidence: Person_evidence: WBPerson9765
  Name: Public_name: ky5
    Other_name: ZK512.6a.1:c.15_326del
      CE01109:p.Glu6_Ter109delextTer?
    HGVSg: CHROMOSOME_III:g.9136930_9137543del
  Sequence_details: SMap: S_parent: Sequence: ZK512
    Flanking_sequences: TCATTTTCAGAAACCATGTCGTCATGGAA TGTAAGACACGATAAAAAAATTATGCAAAA
    Mapping_target: ZK512
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005282
      WBStrain00005551
      WBStrain00005552
      WBStrain00005553
      WBStrain00027259
    Laboratory: CX
    Status: Live
  Affects: Gene: WBGene00001135
    Transcript: ZK512.6b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-263
        CDS_position: ?-263
        Protein_position: ?-88
        Intron_number: 1/10
        Exon_number: 1-2/11
      ZK512.6a.1 (11)
    Interactor: WBInteraction000578897
      WBInteraction000578898
      WBInteraction000578899
  Genetics: Interpolated_map_position: III 0.17242
  Description: Phenotype (14)
    Phenotype_not_observed: WBPhenotype:0000006 Paper_evidence: WBPaper00032082
        Curator_confirmed: WBPerson712
        Remark: All these animals retained a similar number of eggs when compared to wild-type animals (~10 eggs). Paper_evidence: WBPaper00032082
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Young well-fed animals were scored Paper_evidence: WBPaper00032082
              Curator_confirmed: WBPerson712
          Temperature: 25 Paper_evidence: WBPaper00032082
              Curator_confirmed: WBPerson712
      WBPhenotype:0000631 Paper_evidence: WBPaper00035198
        Curator_confirmed: WBPerson712
        Remark: Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). Paper_evidence: WBPaper00035198
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00004251 Paper_evidence: WBPaper00035198
              Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Paper_evidence: WBPaper00038117
        Curator_confirmed: WBPerson712
        Remark: eat-4(ky5) mutants did not show locomotion defects. Paper_evidence: WBPaper00038117
            Curator_confirmed: WBPerson712
      WBPhenotype:0001182 Paper_evidence: WBPaper00032082
        Curator_confirmed: WBPerson712
        Remark: Fat levels were similar to that seen in wild-type but are reduced when compared to daf-7(e1375) as determined by Sudan Black assay (described in Kimura et al., 1997). Paper_evidence: WBPaper00032082
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: To minimize staining variability, which allowed for quantitative comparisons between various genotypes: animals from one genotype were labeled with fluorescein isothiocyanate (FITC) and then fixed and stained in the same tube as unlabeled animals from another genotype. Paper_evidence: WBPaper00032082
              Curator_confirmed: WBPerson712
          Temperature: 22 Paper_evidence: WBPaper00032082
              Curator_confirmed: WBPerson712
      WBPhenotype:0001291 Paper_evidence: WBPaper00038117
        Curator_confirmed: WBPerson712
        Remark: Animals dispersed less than wild-type animals in the absence of a temperature gradient. Paper_evidence: WBPaper00038117
            Curator_confirmed: WBPerson712
      WBPhenotype:0001765 Paper_evidence: WBPaper00031936
        Curator_confirmed: WBPerson2021
        Remark: Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 Paper_evidence: WBPaper00031936
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00031936
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: 10% CO2 Paper_evidence: WBPaper00031936
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001780 Paper_evidence: WBPaper00029060
        Curator_confirmed: WBPerson2021
        Remark: Mutants show normal butanone enhancement Paper_evidence: WBPaper00029060
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00029060
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays Paper_evidence: WBPaper00029060
              Curator_confirmed: WBPerson2021
      WBPhenotype:0002469 Paper_evidence: WBPaper00005404
        Curator_confirmed: WBPerson10038
        Remark: quoted from paper: "Figure 4A shows the average response magnitudes for reversals in the three blocks of training on day 1 and the test block on day 2. When stimulated with trains of taps, the eat-4 worms showed normal short term habituation over each block of stimuli." Paper_evidence: WBPaper00005404
            Curator_confirmed: WBPerson10038
        Phenotype_assay: Control_strain: WBStrain00000001 Paper_evidence: WBPaper00005404
              Curator_confirmed: WBPerson10038
      WBPhenotype:0002568 Paper_evidence: WBPaper00005404
        Curator_confirmed: WBPerson10038
        Remark: quoted from paper: "Using the new group-training procedure with the stronger train of taps resulted in significant long-term memory for habituation training in the group of eat-4 mutants that received distributed training (t(34)=2.54, P<0.05) when compared with the single train control group (Fig. 5)." Paper_evidence: WBPaper00005404
            Curator_confirmed: WBPerson10038
        Phenotype_assay: Control_strain: WBStrain00000001 Paper_evidence: WBPaper00005404
              Curator_confirmed: WBPerson10038
  Reference (19)
  Method: Deletion_allele