WormBase Tree Display for Variation: WBVar00088385
expand all nodes | collapse all nodes | view schema
WBVar00088385 | Evidence | Person_evidence | WBPerson9765 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky5 | |||||||
Other_name | ZK512.6a.1:c.15_326del | ||||||||
CE01109:p.Glu6_Ter109delextTer? | |||||||||
HGVSg | CHROMOSOME_III:g.9136930_9137543del | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK512 | |||||
Flanking_sequences | TCATTTTCAGAAACCATGTCGTCATGGAA | TGTAAGACACGATAAAAAAATTATGCAAAA | |||||||
Mapping_target | ZK512 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005282 | ||||||||
WBStrain00005551 | |||||||||
WBStrain00005552 | |||||||||
WBStrain00005553 | |||||||||
WBStrain00027259 | |||||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001135 | |||||||
Transcript | ZK512.6b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-263 | ||||||||
CDS_position | ?-263 | ||||||||
Protein_position | ?-88 | ||||||||
Intron_number | 1/10 | ||||||||
Exon_number | 1-2/11 | ||||||||
ZK512.6a.1 (11) | |||||||||
Interactor | WBInteraction000578897 | ||||||||
WBInteraction000578898 | |||||||||
WBInteraction000578899 | |||||||||
Genetics | Interpolated_map_position | III | 0.17242 | ||||||
Description | Phenotype | WBPhenotype:0000019 | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited reduced pumping rates similar to daf-7(e1372). | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Pumping rates were assayed for well-fed , pheromone-untreated; food-deprived, pheromone-untreated; and well-fed, pheromone-treated animals. Pheromone treatment consisted of transfer of animals grown under well-fed conditions to plates containing 30 ul/ml of a dauer-pheromone prep (Golden and Riddle, 1982) and 30 ml of OP50 E. coli food. | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000412 | Paper_evidence | WBPaper00003408 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00038117 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No mutants exhibited isothermal tracking behaviour. | Paper_evidence | WBPaper00038117 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000556 | Paper_evidence | WBPaper00006375 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not modulate their ARS frequency of high-angled turns in the presence of dopamine unlike wild-type worms. | Paper_evidence | WBPaper00006375 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000662 | Paper_evidence | WBPaper00006375 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ARS defective. Animals do not exhibit a decrease in the frequency of high-angled turns in response to food deprivation. | Paper_evidence | WBPaper00006375 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00003408 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000999 | Paper_evidence | WBPaper00038117 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited little tendency to migrate towards cultivation temperature and dispersed more broadly from cultivation temperature than wild-type animals on a thermal gradient. | Paper_evidence | WBPaper00038117 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001049 | Paper_evidence | WBPaper00048845 | |||||||
Curator_confirmed | WBPerson3990 | ||||||||
Remark | reduced sensitivity in acidic pH avoidance | Paper_evidence | WBPaper00048845 | ||||||
Curator_confirmed | WBPerson3990 | ||||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00003408 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not show avoidance to NaCl after pre-exposure. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001462 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed strong chemotaxis defects compared to wild type. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001983 | Paper_evidence | WBPaper00060628 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | eat-4 mutants were significantly enhanced food leavers (eat-4(ky5) (Fig. 1B, See time course over 60 minutes, Lee et al., 1999). eat-4(ky5) mutants show a significant increase in the number of worms that were not on the food at time points across 15, 30, 45 and 60 minutes (Fig. 1B). | Paper_evidence | WBPaper00060628 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002545 | Paper_evidence | WBPaper00060628 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | eat-4 mutants again did show an obvious food leaving phenotype when compared to wild type animals on Comamonas sp food lawns (eat-4(ky5) tested), Fig. 1D). We examined strains that selectively rescue eat-4 in specific sets of glutamatergic neurons. eat-4 is expressed in over 30 neurons in the hermaphrodite, including, sensory and interneurons (Serrano-Saiz et al., 2013). We examined eat-4 mutants that were rescued using the odr-3 promoter that expresses strongly in the AWC sensory neurons, weakly in the AWB sensory neurons and faintly in the AWA, ASH and ADF sensory neurons (Royaie et al., 1998, Chalasani et al., 2007, Calhoun et al., 2015, Fig. 1F). Interestingly, eat-4 rescue using an odr-3 promoter rescued eat-4(ky5) mutants for staying on a food patch (Fig. 1F). | Paper_evidence | WBPaper00060628 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00016436 | ||||||||
WBPhenotype:0002568 | Paper_evidence | WBPaper00005404 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | quoted from paper: "When the mean reversal magnitudes to the 10 test single-taps were compared between the trained group and their single-tap controls (t(42)=0.38, P=0.71; Fig. 5), the eat-4 worms showed no evidence of long-term memory for the habituation to tap training." | Paper_evidence | WBPaper00005404 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Rescued_by_transgene | WBTransgene00016287 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00005404 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All these animals retained a similar number of eggs when compared to wild-type animals (~10 eggs). | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Young well-fed animals were scored | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00038117 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | eat-4(ky5) mutants did not show locomotion defects. | Paper_evidence | WBPaper00038117 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00032082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Fat levels were similar to that seen in wild-type but are reduced when compared to daf-7(e1375) as determined by Sudan Black assay (described in Kimura et al., 1997). | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | To minimize staining variability, which allowed for quantitative comparisons between various genotypes: animals from one genotype were labeled with fluorescein isothiocyanate (FITC) and then fixed and stained in the same tube as unlabeled animals from another genotype. | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 22 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001291 | Paper_evidence | WBPaper00038117 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals dispersed less than wild-type animals in the absence of a temperature gradient. | Paper_evidence | WBPaper00038117 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00005404 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | quoted from paper: "Figure 4A shows the average response magnitudes for reversals in the three blocks of training on day 1 and the test block on day 2. When stimulated with trains of taps, the eat-4 worms showed normal short term habituation over each block of stimuli." | Paper_evidence | WBPaper00005404 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00005404 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0002568 | Paper_evidence | WBPaper00005404 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | quoted from paper: "Using the new group-training procedure with the stronger train of taps resulted in significant long-term memory for habituation training in the group of eat-4 mutants that received distributed training (t(34)=2.54, P<0.05) when compared with the single train control group (Fig. 5)." | Paper_evidence | WBPaper00005404 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00005404 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
Reference (19) | |||||||||
Method | Deletion_allele |