WormBase Tree Display for Strain: WBStrain00054654
expand all nodes | collapse all nodes | view schema
| WBStrain00054654 | Genotype | pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. | ||
|---|---|---|---|---|
| Public_name | AX7884 | |||
| Contains | Gene | WBGene00004076 | ||
| WBGene00004258 | ||||
| WBGene00009319 | ||||
| WBGene00017864 | ||||
| Properties | Outcrossed | x0 | ||
| CGC_received | 07 Sep 2022 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson22706 | |||
| Remark | Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC)encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases.Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017. | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
