WormBase Tree Display for RNAi: WBRNAi00079052
expand all nodes | collapse all nodes | view schema
| WBRNAi00079052 | Homol | Homol_homol | T24D3:RNAi | |||
|---|---|---|---|---|---|---|
| K04C2:RNAi | ||||||
| Y49E10:RNAi | ||||||
| ZK507:RNAi | ||||||
| CHROMOSOME_III:RNAi | ||||||
| Sequence_info | DNA_text | atggcctacccttaccccgttttcaatgctgaaaatgtctttgacaatacccagcaacaagttggattctatgattattcaactccattcaatggtacatactcctttactactgactattcttattataataactactatgactatgtcaatacttatgcttcttattatccaactgcaatggattcttcatctttaaatatttcatcaactactggaagtcctaattcttcacatttcaccacgtttactcatttttccactccatctacatctccatctacctctactcaaagttcaactacaccgagcaattctgataataagaagtcatttcaatgctcaaattgttcagtaactgaaacaattcgttggaggaatattcgatcaaaggaaggaattcaatgtaatgcttgtttcatttatcaacggaaatataataagactcgtccagtcactgccgttaacaaatatcaaaaaagaaaattaaaggtacaggaaacgaatggtgtagattcattttaa | ||||
| PCR_product | sjj_F02A9.6 | |||||
| sjj_Y49E10.14 | ||||||
| Experiment | Laboratory | JR | ||||
| Date | 25 Jan 2001 00:00:00 | |||||
| Delivered_by | Injection | |||||
| Inhibits | Predicted_gene | Y49E10.14a | Inferred_automatically | RNAi_primary | ||
| F02A9.6 | Inferred_automatically | RNAi_primary | ||||
| T24D3.1 | Inferred_automatically | RNAi_primary | ||||
| K04C2.6 | Inferred_automatically | RNAi_primary | ||||
| Y49E10.14b | Inferred_automatically | RNAi_primary | ||||
| Gene | WBGene00003180 | Inferred_automatically | RNAi_primary | |||
| WBGene00003181 | Inferred_automatically | RNAi_primary | ||||
| WBGene00001609 | Inferred_automatically | RNAi_primary | ||||
| WBGene00004027 | Inferred_automatically | RNAi_primary | ||||
| Transcript | Y49E10.14a.1 | Inferred_automatically | RNAi_primary | |||
| F02A9.6.1 | Inferred_automatically | RNAi_primary | ||||
| T24D3.1.1 | Inferred_automatically | RNAi_primary | ||||
| Y49E10.14b.1 | Inferred_automatically | RNAi_primary | ||||
| K04C2.6.1 | Inferred_automatically | RNAi_primary | ||||
| Species | Caenorhabditis elegans | |||||
| Interaction | WBInteraction000050898 | |||||
| Reference | WBPaper00004636 | |||||
| Phenotype | WBPhenotype:0001375 | Remark | Loss of ceh-22::GFP expression (pharyngeal marker) | |||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| WBPhenotype:0001637 | Penetrance | Incomplete | ||||
| Range | 41 | |||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| WBPhenotype:0001646 | Remark | Synthetic phenotype: glp-1(RNAi)/pie-1(RNAi) double RNAi and med-1/2 RNAi do not give this phenotype. glp-1(RNAi)/pie(RNAi)/med-1/2(RNAi) results in the no_pharynx phenotype | ||||
| Penetrance | Incomplete | |||||
| Range | 60 | |||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| Remark | Exact sequence used for glp-1 and pie-1 RNAi not stated by authors, Ahringer laboratory clone used for curation. Exact sequence used for med-1/2 RNAi not stated by authors, spliced coding region sequence of med-1 gene used for curation. | |||||
| Method | RNAi |
