WormBase Tree Display for Expr_pattern: Expr6981
expand all nodes | collapse all nodes | view schema
| Expr6981 | Expression_of | Gene | WBGene00001758 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00001758 | ||
| Homol | Homol_homol | Y45G12C:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0004292 | ||
| WBbt:0005394 | |||
| WBbt:0005733 | |||
| WBbt:0005735 | |||
| WBbt:0005772 | |||
| WBbt:0006751 | |||
| WBbt:0006753 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [gst-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGCGTTTGCACTTCCA] 3' and primer B 5' [CGTACGAGCTCTTATCGTTTAGGT] 3'. | |
| Pattern | Adult Expression: intestine; anal depressor muscle; hypodermis; Nervous System; head neurons; amphids; tail neurons; phasmids; | ||
| Larval Expression: intestine; anal depressor muscle; hypodermis; Nervous System; head neurons; amphids; tail neurons; phasmids; | |||
| Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
| Strain: BC12145 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002838 |
