WormBase Tree Display for Expr_pattern: Expr6981
expand all nodes | collapse all nodes | view schema
Expr6981 | Expression_of | Gene | WBGene00001758 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001758 | ||
Homol | Homol_homol | Y45G12C:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0004292 | ||
WBbt:0005394 | |||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0006751 | |||
WBbt:0006753 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [gst-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGCGTTTGCACTTCCA] 3' and primer B 5' [CGTACGAGCTCTTATCGTTTAGGT] 3'. | |
Pattern | Adult Expression: intestine; anal depressor muscle; hypodermis; Nervous System; head neurons; amphids; tail neurons; phasmids; | ||
Larval Expression: intestine; anal depressor muscle; hypodermis; Nervous System; head neurons; amphids; tail neurons; phasmids; | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
Strain: BC12145 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002838 |