WormBase Tree Display for Expr_pattern: Expr6646

Expr6646 Expression_of: Gene: WBGene00023408
    Reflects_endogenous_expression_of: WBGene00023408
  Homol: Homol_homol: T09A5:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0005733
      WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0005772
      WBbt:0006751
  Type: Reporter_gene: [T09A5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAAATTATAGTGCCGAAGCAT] 3' and primer B 5' [CAGCTTTTGGATGGATATCTGAC] 3'.
  Pattern: Adult Expression: intestine; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
    Larval Expression: intestine; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
  Remark: Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated.Strain not available.
    Strain: BC11605
  Reference: WBPaper00006525
  Transgene: WBTransgene00002634