WormBase Tree Display for Expr_pattern: Expr6646
expand all nodes | collapse all nodes | view schema
Expr6646 | Expression_of | Gene | WBGene00023408 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00023408 | ||
Homol | Homol_homol | T09A5:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [T09A5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAAATTATAGTGCCGAAGCAT] 3' and primer B 5' [CAGCTTTTGGATGGATATCTGAC] 3'. | |
Pattern | Adult Expression: intestine; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: intestine; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated.Strain not available. | ||
Strain: BC11605 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002634 |