Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6646

expand all nodes | collapse all nodes | view schema

Name Class

Expr6646Expression_ofGeneWBGene00023408
Reflects_endogenous_expression_ofWBGene00023408
HomolHomol_homolT09A5:Expr
Expression_data (2)
TypeReporter_gene[T09A5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAAATTATAGTGCCGAAGCAT] 3' and primer B 5' [CAGCTTTTGGATGGATATCTGAC] 3'.
PatternAdult Expression: intestine; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: intestine; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated.Strain not available.
Strain: BC11605
ReferenceWBPaper00006525
TransgeneWBTransgene00002634