WormBase Tree Display for Expr_pattern: Expr6624

Expr6624 Expression_of: Gene: WBGene00005049
    Reflects_endogenous_expression_of: WBGene00005049
  Homol: Homol_homol: T06G6:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005772
      WBbt:0006751
  Type: Reporter_gene: [sra-23::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACAGAAGGCGAGGCAAGAC] 3' and primer B 5' [AAAACGGAAGAAAAAGCGTTC] 3'.
  Pattern: Adult Expression: intestine; Nervous System; head neurons; unidentified cells in head;
    Larval Expression: intestine; Nervous System; head neurons; unidentified cells in head;
  Remark: Also expressed in (comments from author) : 2 low intensity GFP cells in the head.
    Strain: BC12001
  Reference: WBPaper00006525
  Transgene: WBTransgene00002782