WormBase Tree Display for Expr_pattern: Expr6624
expand all nodes | collapse all nodes | view schema
Expr6624 | Expression_of | Gene | WBGene00005049 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00005049 | ||||
Homol | Homol_homol | T06G6:Expr | |||
Expression_data | Life_stage (2) | ||||
Anatomy_term | WBbt:0005735 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0006751 | |||||
Type | Reporter_gene | [sra-23::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACAGAAGGCGAGGCAAGAC] 3' and primer B 5' [AAAACGGAAGAAAAAGCGTTC] 3'. | |||
Pattern | Adult Expression: intestine; Nervous System; head neurons; unidentified cells in head; | ||||
Larval Expression: intestine; Nervous System; head neurons; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : 2 low intensity GFP cells in the head. | ||||
Strain: BC12001 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002782 |