WormBase Tree Display for Expr_pattern: Expr6624
expand all nodes | collapse all nodes | view schema
Expr6624 | Expression_of | Gene | WBGene00005049 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00005049 | ||
Homol | Homol_homol | T06G6:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [sra-23::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACAGAAGGCGAGGCAAGAC] 3' and primer B 5' [AAAACGGAAGAAAAAGCGTTC] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; head neurons; unidentified cells in head; | ||
Larval Expression: intestine; Nervous System; head neurons; unidentified cells in head; | |||
Remark | Also expressed in (comments from author) : 2 low intensity GFP cells in the head. | ||
Strain: BC12001 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002782 |