WormBase Tree Display for Expr_pattern: Expr5726
expand all nodes | collapse all nodes | view schema
Expr5726 | Expression_of | Gene | WBGene00006626 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006626 | ||
Homol | Homol_homol | F10G7:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (17) | |||
Type | Reporter_gene | [tsn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCGGGACGATCAGGT] 3' and primer B 5' [TCAGTGATTCTCTTTTGTTGCTTC] 3'. | |
Pattern | Adult Expression: pharynx; intestine; stomato-intestinal muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; intestine; stomato-intestinal muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | |||
Picture | WBPicture0000009220 | ||
WBPicture0000009221 | |||
WBPicture0000009222 | |||
WBPicture0000009223 | |||
Remark | Also expressed in (comments from author) : Neural GFP intensity is highly variable. Tissue expression also varies between worms: pharynx, gut, rectal epithelium, vulval, and body wall muscle are consistent. | ||
Strain: BC10537 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002300 |