WormBase Tree Display for Expr_pattern: Expr5726
expand all nodes | collapse all nodes | view schema
Expr5726 | Expression_of | Gene | WBGene00006626 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006626 | ||||
Homol | Homol_homol | F10G7:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003679 | ||||
WBbt:0003681 | |||||
WBbt:0003822 | |||||
WBbt:0003833 | |||||
WBbt:0005319 | |||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005753 | |||||
WBbt:0005772 | |||||
WBbt:0005800 | |||||
WBbt:0005812 | |||||
WBbt:0005813 | |||||
WBbt:0006748 | |||||
WBbt:0006751 | |||||
Type | Reporter_gene | [tsn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCGGGACGATCAGGT] 3' and primer B 5' [TCAGTGATTCTCTTTTGTTGCTTC] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; stomato-intestinal muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; intestine; stomato-intestinal muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | |||||
Picture | WBPicture0000009220 | ||||
WBPicture0000009221 | |||||
WBPicture0000009222 | |||||
WBPicture0000009223 | |||||
Remark | Also expressed in (comments from author) : Neural GFP intensity is highly variable. Tissue expression also varies between worms: pharynx, gut, rectal epithelium, vulval, and body wall muscle are consistent. | ||||
Strain: BC10537 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002300 |