WormBase Tree Display for Expr_pattern: Expr5621
expand all nodes | collapse all nodes | view schema
Expr5621 | Expression_of | Gene | WBGene00006520 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006520 | ||||
Homol | Homol_homol | D2013:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005738 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005772 | |||||
WBbt:0005813 | |||||
WBbt:0006751 | |||||
Type | Reporter_gene | [D2013.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAGGTTGTCCTGAATAGTGAT] 3' and primer B 5' [TCTGAATGTTAAATTCTTTTGTGC] 3'. | |||
Pattern | Adult Expression: pharynx; body wall muscle; Nervous System; head neurons; | ||||
Larval Expression: pharynx; intestine; Reproductive System; body wall muscle; hypodermis; Nervous System; head neurons; unidentified cells in body ; | |||||
Picture | WBPicture0000004427 | ||||
WBPicture0000004428 | |||||
WBPicture0000004429 | |||||
WBPicture0000004430 | |||||
Remark | Also expressed in (comments from author) : unidentified tissues in the developing reproductive systemMosaic population. | ||||
Strain: BC13002 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002289 |