WormBase Tree Display for Expr_pattern: Expr5621
expand all nodes | collapse all nodes | view schema
| Expr5621 | Expression_of | Gene | WBGene00006520 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00006520 | ||
| Homol | Homol_homol | D2013:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [D2013.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAGGTTGTCCTGAATAGTGAT] 3' and primer B 5' [TCTGAATGTTAAATTCTTTTGTGC] 3'. | |
| Pattern | Adult Expression: pharynx; body wall muscle; Nervous System; head neurons; | ||
| Larval Expression: pharynx; intestine; Reproductive System; body wall muscle; hypodermis; Nervous System; head neurons; unidentified cells in body ; | |||
| Picture | WBPicture0000004427 | ||
| WBPicture0000004428 | |||
| WBPicture0000004429 | |||
| WBPicture0000004430 | |||
| Remark | Also expressed in (comments from author) : unidentified tissues in the developing reproductive systemMosaic population. | ||
| Strain: BC13002 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002289 |
