WormBase Tree Display for Expr_pattern: Expr5431
expand all nodes | collapse all nodes | view schema
| Expr5431 | Expression_of | Gene | WBGene00006701 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00006701 | ||
| Homol | Homol_homol | C35B1:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (11) | |||
| Type | Reporter_gene | [ubc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACGATGATATTAGTCCAGAAA] 3' and primer B 5' [TGGGCGTCGTGATATTGAT] 3'. | |
| Pattern | Adult Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; | ||
| Larval Expression: intestine; rectal gland cells; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; | |||
| Picture | WBPicture0000009297 | ||
| Remark | Also expressed in (comments from author) : unidentified cells in head and tail, neural. | ||
| Strain: BC12994 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004504 |
