WormBase Tree Display for Expr_pattern: Expr5431
expand all nodes | collapse all nodes | view schema
Expr5431 | Expression_of | Gene | WBGene00006701 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006701 | ||||
Homol | Homol_homol | C35B1:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003679 | ||||
WBbt:0004070 | |||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005753 | |||||
WBbt:0005772 | |||||
WBbt:0005799 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [ubc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACGATGATATTAGTCCAGAAA] 3' and primer B 5' [TGGGCGTCGTGATATTGAT] 3'. | |||
Pattern | Adult Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: intestine; rectal gland cells; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; | |||||
Picture | WBPicture0000009297 | ||||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, neural. | ||||
Strain: BC12994 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004504 |