WormBase Tree Display for Expr_pattern: Expr5431
expand all nodes | collapse all nodes | view schema
Expr5431 | Expression_of | Gene | WBGene00006701 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006701 | ||
Homol | Homol_homol | C35B1:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [ubc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACGATGATATTAGTCCAGAAA] 3' and primer B 5' [TGGGCGTCGTGATATTGAT] 3'. | |
Pattern | Adult Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: intestine; rectal gland cells; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; | |||
Picture | WBPicture0000009297 | ||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, neural. | ||
Strain: BC12994 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004504 |