Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5431

expand all nodes | collapse all nodes | view schema

Name Class

Expr5431Expression_ofGeneWBGene00006701
Reflects_endogenous_expression_ofWBGene00006701
HomolHomol_homolC35B1:Expr
Expression_data (2)
TypeReporter_gene[ubc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACGATGATATTAGTCCAGAAA] 3' and primer B 5' [TGGGCGTCGTGATATTGAT] 3'.
PatternAdult Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: intestine; rectal gland cells; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ;
PictureWBPicture0000009297
RemarkAlso expressed in (comments from author) : unidentified cells in head and tail, neural.
Strain: BC12994
ReferenceWBPaper00006525
TransgeneWBTransgene00004504