WormBase Tree Display for Expr_pattern: Expr5120

Expr5120 Expression_of: Gene: WBGene00015368
    Reflects_endogenous_expression_of: WBGene00015368
  Homol: Homol_homol: C03A7:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005772
      WBbt:0006751
      WBbt:0006759
  Type: Reporter_gene: [srt-65::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGTACCTCCTTAGCTGTTTATCA] 3' and primer B 5' [AATTCGGTACGACCATAAAAA] 3'.
  Pattern: Adult Expression: intestine; Nervous System; head neurons; tail neurons; unidentified cells in head;
    Larval Expression: intestine; Nervous System; head neurons; tail neurons; unidentified cells in head;
  Picture: WBPicture0000003635
    WBPicture0000003636
  Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product.
    Strain: BC15345
  Reference: WBPaper00006525
  Transgene: WBTransgene00003936